Description :
From Genome Similarity Track
Location :
Scaffold_30:18767- 21838
Transcript NameFunction/comments
Physo_134095hypothetical protein

Sequence
3071 bases(100 bases per row)
GTGCTAATATCACTACTAATTCCCCGAACTTCAACCCACGTAAGATCTTCAAAAGGCGCGCAAATTGGTGGTTCTCCGACCCCCCCCCCCCCCCGCGCTT
CGAGCTCTTTCGCTCATTTCTCGATTCTCAGGTAAAGCCAGACTGATGAAGTGTGCTAATATAGACTGACATTGGGGGAATCTAGAGGAGACTTCGCCGT
GCAGTGTGTGTGGTCGGCCCGTGCATCACTTGTGCAGCAATGAACTCTGCACCAAGCCCGACGTCGACCTCGCGAAAAGGTAGCGCTACCATTAGTGGTC
TTTGCACATAACTTTTGCTTACTGATGCTCTACATGCAGGTTCTGCAGCCACGCTTGCGTGAGCAGGTTCTTCAATACGGACAGCGACTCCCAGGAGTTC
ACGCCAAGCAGCCAATCCGGCATATCGTGTTCCAGCAACGCCACTGTGATCGACCTCGCCCAACATGACGCCGAAGAAAAAGAAGAGCCCGTTAACAGTA
TCCCCGATCATGTCGTCTACAAGCCGCCAGCAAACTCGACCGACCCGGTGTGGGAGCTGATCCACCGCTTGGATACACCTTCCATCTACGAGGCCAAGAC
GTACACGCATATTTGTCTGCTTTGCGTGCAGACGAAGACGTGGCAGGACTCACTCTGCCGCGCTGGCAACGCATCGAACGCTAAGACCCATCTAGTGTCC
ATTCATAAGGACCATGAGTTGGCTATCCAAGAGCAGCGGCGCCGGCTAACCCGTGCAGACCGCTACATGGTGCAGGTGGGGCCCAAAAATGAAACCAAGC
GGGAAGTTTCTCCAAAAGCAAGATCACAAGCAGATCACCCCCTAAAGCGCCAGAAAACGTTGTGGTCAACTTCGGGGAGCAGATAACGGGCCATATAGCA
CGGTGGCTGATTCATGATGGTGCGTTTTTAAAAACTTTTATGACTTTGAAAGCTGCTAAATCTCATTATTGCTATGTGTATCTGTGCCTAGGGCATGCGC
ACAACATGGTGACGACTGCTGCTTTTCATGAAATGCTCGTCGGCATTACGGGCAACCCGAATGTCACTGTACCCCCCACCAAGATGTATAACGACATTTT
GGACAACCATTTCGAGAAGTTTACAGCGGACGCAGCTGAGATGTTCATCGAAGAGTTTCAAGAGCTGGATGAAACGTCATGACGGTGGAGCACGACCTAT
GGACAAACAGCGCAAAGAATAACATTGTTGGAGTTCAGGCAGTTATATCAACCACCAGTGGCGACCTGTACGCCTTGCTCTCCTTGCTCACGTGAAGAAC
GATGGACATGATTCCAAAGAAGTGGGCAAACTGATGAATAATCAACTGAAGACACGCTACGGTCTGGATGTGAACAAAATGGCTCGCTTCACGATATCGG
ACACTGCTCCAGGCGCGCGAAAAATATCGAGGCAATTCGACTCGACCCTGCAGACGGACTGTGCGATGCACGCACTCAATCTCTGTATTGGCTATGGCAT
CGGGTTGAAGGAGAATGTGCGCAACGAGTACAAGAAAGACCCAAAGTCGGAGGCGTACGTCAAGACGCGGACTGTTGTGACAAAAGGTGGGGCATTCCCA
GAAGGTGGCAAGGTGATTCGAAAACTACGTGCTCTAAACAACTTCTTTGCTTCGAGCAAGTCCCCGGAGCGTGTCGCCCGCCTCAAGGACGTCCAAAAAT
TTCACAAGCTACCCCAGCTAGCAGCTTTGGTGGACATCGACGTTCGCGTGGCGTCCACGATTAAGTTGTTTCAGCGTTTGATCATCAACTTTTCTGCGTT
CCAGGCATTTTTCCTGAGCGCAAACGTGGCCAAGGACGAGAAGCATGTCTTCAACCGAATCACCGACGCAGAATGGGCGTTAGTGATTCAAATGGAGGCG
ATCATGCAGCGCGTGGCAGAGTTAGCACTCGTGGAGGCTCAGTCGGCGTCCATGCTTTCTTCGACTATGTATGTGCTGCTGCGTGTGGCTTCCGCTCGCA
TGAACTCGTACAAGTTCTCAGCCTACTGTCTAAATGGTGCTCGTGACACGGGGACGAATGAGAAAAACTTCCCGCGGGTCCAGCTAACGTTGCCCGATTT
ATCGGAGCTCGCTCAGCGATGCATCACGCGAACGCTTCACCAAATTGCTGAGCGTCTCCCACAGCCGTCCGTGCCTATGGGTGTGGCCTTGCTACTCGAT
CCACGCACGAAGTCATCTGCCAAACAATTCCTTCGCATTCCTGACACAGCGGAGGCTGCCACAGACAAGATATTGGAGGATGCGAAGGAGCTAATGCGCG
TCGAGCACCGGGTTTTCTTCAAGGGTCTGCATGCACGTGACAAGGAAAACGTCCACGACGCAGCGTCTGCATCAAACTCCCCACCAAGAGAGGCTAACAG
TGGTTCAGACACTGAGGCTGACTTGCTGTATGGTGAAGAGGTATCTCAGCCGTCTGAGGAGGCCAGTGCTGATGCCATGATCAACTCCAAGGCGGATGCG
TTGCTAGACCAGTGGTTTGACCTTCGAGTCGATTGGGCTGAGGTGGCTAAAAGGCAGTATCCCGCCGAAGACGAGTACGATACCGTGCTGGCTAAGCTGA
GCGTGCGCGACAAAAAACGAGGTGTTCGTGTGTGGAATGTTGAGCAAGTATGCAACAACATTGACGTCTGCAGCTGGTTTCTCGAGGCTGGGCAGAAGGA
GTTCCCGTCAGTTGCAAAACTGGCACGCGTCTGGCTGGGACGGGGCTGCTCAACTGCGTTCCAAGAACGCGTGTTCTCTACAGGCTCCTTTGTGATGAGT
CCACCAAGAACGCGGACTGCCAACGAGCGAGCACAAAGGCAGCTGATACTGCGCCACAATCGTCTCGAGCTCGCGCGCATGGAGGAAAGTAAGCGGCAGA
TCTGGTAAGCTCCGACAGTCTGGATAGTAGTGCTATAGTAGTGATATTAGTAGTGATAACTACTAATTTCGTTTCTTCACTACTAGTAGTAGTAGTAGTG
ATAGTGACTCACAGTCGAATAATAGTAGTAGTATCACTACTAGCCAGAATTCTCACTACTACCAAACCCTG