Description :
From Genome Similarity Track
Location :
Scaffold_78:18767- 19783
Sequence
1016 bases(100 bases per row)
tcatcacccgtagatgactcgtgctgcacgtacggcttcaaccgcccgacgtagaacgtcggatggagtctcatgctggacggtatgtccagccggtacg
cgttaccgtgccgttcaagtactttgacggcccgatgaaccttggagcaagcttacttgctccaaaatcagacactgcatgtttaggtaggttttgtgta
gcttacaaaaccaatgaacccttattgaattcattaatgttgcccctaccaacattgtctgcgttcagcttctgtcgatcgacagaagctgcgatagcat
cttgcacaaaccgtattacggcttgtcttcgctggacaaagtctagcgcattcgagctgagccctagcacgtcgccttcatccgcagcaggccctgcctg
ctcgctatcatcccctatgtctgtgcccggcacagacatctcgcgctcgttcctgctcgaacgagacgcagctcgtgtcaccgcagctgatagtacgtcg
tcagctgtcctctgcggttgttcagacgcaaccgtagatcctcccccacttannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncaccgagttgttgatggtaaactctgccatcggtaaacactcgctcca
atgcgggaacgagtgtgcgtagctcttcagcgcgtcaaccagtactcggttgacgcgtttagtctggccgtccgtctgcggatggtccgcagtcgacatt
gacaactgtgaaccaagaagtgtaaacacttcttgccagaaccgcgctgtgaagcgtggatcacggtccgacacaatgtcgagcggcatgccatggtgtt
tgaacaccatgtcaacaaacagtcgcgcagtctgcgcggttgtaacagtagccgggacggcagaaagatggaccatcttgctgaatcggtccacgacgac
aacgatgcctgtcctc