Description :
From Genome Similarity Track
Location :
contig_113:1876- 3024
Sequence
1148 bases(100 bases per row)
TGGGAGTGTCTGAGTATGAGCTCACTCCTGTGTAACACATGCAGCAGGTTTACTCTAGTGCCGTTCCTCGAGCGCCATCTTTCCGCCGCCATCCCACAGC
CTTGCTTGTGCTCTTCTCTGTGTGCCGAGGGATCCCGTGGAGCAGATGCCCTAAAGTGATACCCCTGCGTGGAGGAATTGAGCAAAAAGCGTTGGACTGC
GGCCAATGACCAACACCGCAAATTGTCCGCAGGTTGGCTCTGTCAGCACACTAATTTATTTTCCCTGAGCTCCACTGCGACGAATATGGCGTGAATTTGG
CAGGTTGTCGCCTTGAATGCCTCCAGCACCATGTGGCACGCTCACACGCCCGCACTCCTCGAAGATTCACGTGTTCACGCGCACCGATTGCCTGCAAAGT
GATCGTCACCGTACTGTACGGAGGACAGCAGCATGTAGAGCAACCCGTTCCGCTATCCACGCCAAATCGAGCAGCTCTTCCTCAGGAAGTTCCTGGTTGC
TGGCTCTGTAGTGTTTAGTAACATACCACTGTTTACTGGCGCACTGCTCGGCATGGTCCTGGATGCCGCGCTCTATCCATCTCGCGCTGCAGGCTTCGGG
GTGACATGGTGACAGATGACTTGCGCCACACCGAGGTGTTACAGTGCTGCTGGATACACTTCACCGCCAAACTTTGGCGCACCGAGACTCGCGCTCAATC
CGACGTCGCGGTTTTTACCCGCATTAGCTTCGGATTCCCGCGTCAAGGTCGAGGTTCTCTCAGGGTCTCTTGCAAGCAAGCGAACGGTGCTTGGGTCAAG
ATGTTAGACGAGCCCTGGCGCGTGATGGCGCGCCGCAACTTGCATCGTCGCCACGAGGCGAGGCCTCTCCAACTTGGAGAGAGGAGACTCCAAGCAGACA
TCGCGAATGCACATGTCGGCGACCATTCCTGGTTGCGCGCATGAGCGTTGTGATCAATAAATTCAGCCGAGCAGAGCGACGCAATATCGCTCCCATCACA
CTGCTCGCGGTCGGGAAGCGTTAAGCTGCCCCTTGCTTGATCTCCGCTGCACCCGACCTCGCGACACGCGAAGCGCGGCTGTGCATGTACAATTGCCCAG
GCGGGTGTCAACTTTGCTGCCGTGTGCGCGCGCGCGACCCAAGTGACT