Description :
From Genome Similarity Track
Location :
Scaffold_16:187515- 189866
Transcript NameFunction/comments
Phyin_T30-4PITG_08664Putative uncharacterized protein

Sequence
2351 bases(100 bases per row)
GCTAGTACAGCGGAAGGACACCTACTGGTACGCCTGGAAGGAGTGGGTATTCAGGGGAACGAGCGAAGAGTGGGGTGAAGTAATCTCACCTACCCAAGTG
ACCGCACGAGAGACTAGCACACTCACAGGGAGGCCAGGTGAACGCATACAGCAACTAATCAGTAGTTGGATGCAGCCCGCGGAGGAACTCACAGCGGACT
CCATCCTGGCGTACCAGAAGAACATCGATAGACTGGAAGCGGAATCATTAAGTTGGACGGTAGCGACGAGATGGATCATAGAGTTACCAATTAAGCTGGA
AACACCGTGGCGAGCGATGACAACCGATGAAGCCATATTCTGGCCAGCCTTCAACTGGAATGCCAATCCGTGGATTCTGGATAAAAGAGGTAACACCCTG
AGTCGGAAGAAATTCGACAGGATACAAAGTTGCACGGTGGAAGCACTACATATCACACGTACCACTGACACTACCTACGAGTTCTCAATTCCCGTTGAGG
GAGAAGCGAAATATCAACAAGCAAAGCTGCGCAGGTGGGGTCTAGCTATCCTACTTAGTGCGCCATCGATCGCAGTTGGGGCAGTACTACAGGTGACGAA
CAAACTTACACTGCGGCATCCACCCACGCTCGTGAAGGGCTTTATCTGGTATATCTTGCAGGATGGAAGAGCACGAGGATCGAGGCCTCCTGGTACAGAA
GCCGAAACAACAACAATCACGTTGGAGCAGATGCCCAATGGCATAACATGGATACCAGTAACATCAAGTCCAGCGGAGACCCAGCCACAGGAGGAATAGA
GAGAGCTAGAACGATTAGGAGAGACTGGTTGTTTAGCCTTCTTCGCGCACCCAAGGATTCACAGTTTCCCATGGACTGTTAAACCCAGCGTCGCAAACAA
ACATGTACTGGCAGTGTTGAAAATGCAACCCTTTAAGAAGTTCAGAGGAGACACTGGCCAACTACGAGGGCACGTACAGCGCCTCCAAGAAATAGTAGCA
GCGAGCAGGTGGCAAAAGGCAGCAATGTAGCAAACGCCGACGCAAGCATGGTCCCACAAACACCAACTCACTGAATACCAGGTATGGGTGAGTTATCGTG
TAGCAGTCCGGCAGCTTAACTTGTATCATGAAGGCCGTCGTCAAGACAACAGTTGGCCAAAGCTACAAGCATGTAAGGGGACAAAGGATACAATAGAACA
TATCTTCTGGGAGTGTCCGTGCGCACAAGCCTGCTGGAGCAAGCTCCTACAGCATTGGACAGGGGAATGCTGGCAACCAGGGTATATTGAAAGGTTTCAG
ATGCAATGCGCTAACCGCAAGGCACCGCAGATATCACAACACGTCCAGAAGCAATTGTGGCTTCAATTCCCAGATGCGGCGAAGGAGACAACGGCCATCT
GGTTGAGAATATGGGAGATATTCTGTAGCATTTGTCTCACAAGCTTATGGATACAGAGAAACCGAGTAGTCTTCCAACAAGATAAGACCACAGAGGAAGC
AAGTAGCCTGGCGTTTTGGGCGACAGCCACGAGACAACTACAAGCACTGGGGAAGCGAGAAAGCCGCAGTCCCGAATCTCAAGAGGAAGGAACGCAATTG
CTGTTATGCTTACGGGTACTAACAACAATACCAAGAGAGCATCCCAGTCCTGGGGTGAGCCTCGTACAACCACCGGACCAACAGGCACCGGCGTTGCTAA
CCAGGCTTAGCCAATATCAGACATCTAGTCGTCTATAAGACTCAATAGAATAGTCTGACTCTCTCTCTCATTACATCACCCACCCACGTCAATGTTTTGA
GTTAGATAGAGCGTCCTATTTAGATAGATCGTTCCTGATATCACACATAAGAGAACTTTAGTAAAACAAGGCTTGGAATAACGAGTATCTGGATAAAAGC
TGAGAATAAATGACGGATAGATTACCGATCGATATTCCTTTACTTTATTCCAGTGGAATAACGCGACCGTTCGCTATTCCACTGGAATATATTGCTGGAC
AAAGAAAGTTATTCCAGAAACAAAAGCTGACCACATGTGCTTACGATTGCGTTTTTGCAGTTTACTGCCTATTCATAGTCAAACAATTGATTATGGCACT
GCGACACACCTTCGTTTACTGCACTCAAGTACGATGTTCTTTTAATGATATGTCTAGTGCACATGAACGAAACAGCATTGCAGGGGGTGGGAGGGGGTGT
CCGACGGGCGAGGCCGATTGTGGCTGATGGTGACAACCTAACGGACACTGGGGCTCCGAATTAGATTCTGTACCTATTGGCTTGTACATATATATTATAC
CCAACATGTAGCCCTTTTCGAACTCCCATGAGCCTAGAAATCCAATCTGTT