Description :
From Genome Similarity Track
Location :
Scaffold_1506:1875- 4449
Sequence
2574 bases(100 bases per row)
AGATCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACGGCGGACCATCCGCAGACCGATGGTCAA
ACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGTGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTCGCAT
TAAATAATGCAATGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCCGCCACGCAGTGGCTCAGG
GCTTGGTGGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAAT
GCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGGCACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGTGAC
CAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTTAAGACCTCGTTCCATAGGACCGTTTCAAGGGTCG
TGGCCAGGGAGGGCCTAGCGTATACGCTCAACCTTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTCGGCTTGCTTAAGCCATACCAAGACCCTG
CTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGCTGGGCCACGGACAGCTGCAGGACAGCAAGTGGTGGATCCACTGATGGCTGATCAACAGCATGT
GGCAGAGCCACAGGTCGCGGAGCGAAGTGCTCGAGATGCAGGAGCAAGGCAAGCTGAACGTTCAGCCGAGCAGCTGGACGCTCAAGGTCCGAGACCTGGT
TGTGAGTCAACAGTGGTGGCTCTAACCTATCCACAAGGTGGATCATCTCTTCGAGATCGACCGATGGGCGGTGAACGTTCGCGTCGTGGACGCCGGCGTC
GTATGGACGCAGACGCCGTTCCGGCAAGTGCTGACTCTCCCCCGCGAGAGCCCCAGCTGAGGCAAGGCCTCCTCCCTGCTCTGCTCGATGTAGCATGTGT
GAGCCTCCCACTCTTCACGTGGAAACGCCTTGTGGCGTGGCGTAGACGCCAGGGTCGTACCCAGTACTTAGTGAGTGGAGGGGTTACCCTCACTCACAGA
ACTCATGGGAGTTTGAGGTTATCCTCCGGCAAGATTGCCCTGACGTCGTTGACGCTTACGACCGGGCACATCATGTGCCGAAGCGCCACCATGGCGTGCG
ACAGCGTCGCCAGGCGCTGGGCGCCTCCCACTAGAGTGGGGAGCGATCAGGTCAGTAGTTGAGCTCAGGCTCTGACCAGTGGCTGCAGCAGCCTGCTCGT
ACGTATGAGCGGTGCTCGCAGCGGGAGCAGGAGGTGGAGAGACCCTCTAGTGTTAGGGACAGGGTCCCGCAAGAGAAAAAAGGAGGGGTCCCCAAGTAAA
CAGTGCCTCTGTTGTTGTTGCAAACAGGTTTTCGGCTACCGAGGCCTCCGCATAGAAAACCTCAATTGTTTTTGCAAAACATTGCTTGCCAAAAACTATA
CCAAAGTGGAGCCTGTACGCAAGGGGTCCCGAGGGACAACATGGCTTGGTTGACGGCCGGAGTCTACCTTGATTATAGGCGATGCCCGTACTCAGTCCGA
GAAAGGACTACTCATGGTATGAGGGGGCTGCGCCCGGGTGGATTTGAACCACCGACCTGTGGCTTTCATAGCCAGCGCTCGACCACTGAGCTGAAAGGGC
GTTGCCCTTAAGCTTGTCCATTCAAGGACAATCGTTCATGGAACGACAGGGCTGTGCCCTGGTGGGTTCGAACCACCGACCTGTGGCTCTCAAGGCCAAC
GCTCAACCATTGAGCTACAAGGGTGTTGCCCTTAAGCTTGTCCAAGCGTGAACAGTCGTTCATGGAACGAGAGGGCTCTGCCCTAGTGGGTTCGAACCAC
GGACCTATCGCTTGTGAAGCGAGTGTCCAACCGCTGAGCTGTTGTCGACGACTCGAATGAGTCAAGAGCATTGCTCTAAGCGGTTTGCAGCTCTTGGAGT
AGGCGCGGAGCGCGAGCGTAGGTCTGAGACCGCTTGAGAGCAAGATGCGCGCTGCGCTTGGAGCATTGGGCCGTGGGCCGACGACGAGAAGTTGGGCATC
AACGATTCGTAGGCGTTTGTGAGCTCACGGAGCTGTACAACGCTGGTGTGAGGTGTAGTAACCTCCGCCGTCTTAACAAGACGTGACCTCGCTGAGGAGA
GTTTCGAGAACGGAATGTTCTCATCTTAGTGGGGGAGAGTGTAACGGGGTTACATGGTGTGGAAAACACAGGGGTACGAAGTACCCGGAGAGTTAACAAA
CTCTCAGTACATAAGTTGGAGAGCTAACAAGGTCTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTGATTAGGTTTAACTATGCTAGATAGTTAA
ACAGATACATTTACCCCTAGGCGGCTTGGCCGCAATAATAGTAAATAAAACACTTCTGGTTTTGAAGCATAAAA