Description :
From Genome Similarity Track
Location :
contig_113:1875- 3021
Sequence
1146 bases(100 bases per row)
TATGAGCTCACTCCTGTGTAACACATGCAGCAGGTTTACTCTAGTGCCGTTCCTCGAGCGCCATCTTTCCGCCGCCATCCCACAGCCTTGCTTGTGCTCT
TCTCTGTGTGCCGAGGGATCCCGTGGAGCAGATGCCCTAAAGTGATACCCCTGCGTGGAGGAATTGAGCAAAAAGCGTTGGACTGCGGCCAATGACCAAC
ACCGCAAATTGTCCGCAGGTTGGCTCTGTCAGCACACTAATTTATTTTCCCTGAGCTCCACTGCGACGAATATGGCGTGAATTTGGCAGGTTGTCGCCTT
GAATGCCTCCAGCACCATGTGGCACGCTTACACGCCCGCACTCCTCGAAGATTCACGTGTTCACGCGCACCGATTGCGTGCAAAGTGATCGTCACCGTAC
TGTACGGAGGACAGCAGCATGTAGAGCAACCCGTTCCGCTACCACGCCAAATCGAGCAGCTCTTCCTCAGGAAGTTCCTGGTTGCTGGCTCTGTAGTGTT
TAGTAACATACCACTGTTTACTGGCGCACTGCTCGGCATGGTCCTGGATGCCGCGCTCTATCCATCTCGCGCTGCAGGCTTCGGGGTGACATGGTGACAG
GTGACTTGCGCCACACTGAGGTGTTACAGTGCTGCTGGATACACTTCCCGCCAAACTTTGGCGCACCGAGACTCGCGCTCAATCCGACGTCGCGGTTTTT
ACCCGCATTAGCTTCGGATTCCCGCGTCAAGGTCGAGGTTCTCAGGGTCTCTTGCAAGCAAGCGAACGGTGCTTGGGTCAAGATGTTAGACGAGCCCTGG
CGCGTGATGGCGCGCCGCAACTTGCATCGTCGCCACGAGGCGGGCCTCTCCAACTTGGAGAGAGGAGACTCCAAGCAGACATCGCGAATGCACATGTCGG
CGACCATTCCTGGTTGCGCGCATGAGCGTTGTGATCAATAAATTCAGCCGAGCAGAGCGACGCAATATCGCTCCCATCACACTGCTCGCGGTCGGGAAGC
GTTAAGCTGCCCCTTGCTTGATCTCCGCTGCACCCGACCTCGCGACACGCGAAGCGCGGCTGTGCATGTACAATTGCCCAGGCGGGTGTCAACTTTGCTG
CCGTGTGCGCGCGCGCGACCCAAGTGACTCACCTCGCGGAAGATAG