Description :
From Genome Similarity Track
Location :
Scaffold_303:18749- 21833
Transcript NameFunction/comments
Albla_Nc14116610phospho2dehydro3deoxyheptonate aldolase putative
Albla_Nc14116600phospho2dehydro3deoxyheptonate aldolase putative
Albla_Nc14116620phospho2dehydro3deoxyheptonate aldolase putative
Albla_Nc14116630
Albla_Nc14116640

Sequence
3084 bases(100 bases per row)
GCGCGCGTATTTTGAGAACGCAAGAACGACGGTCGGATGAAAGGACCCATCAATGATCCAGACCTAAATGAGACGTACAACATCAACAAAGGCTTGAGAG
TGGCCCGAGACCTCTTGGCTCGATTCTACGAGATGCAAATTCCGACTGGGTGTGAGTTTTTGGACACCATGTCGCCTCAATTTTTTAGCGATATGGTCAA
TTAGGGTGCAATTGGTGCAAGGACTACTGAGTGTCAGCTACATCGGGAATTGACGGCTGGGCTTTCCATGCCAATCGGATTCAACAATGGAACTGGAGGC
TCTTTGTGAGTGTTCTACAGATTCTGGTCACTCGATATCATACTAACTACTTTGCATCCTCAGGGAACTAGCAGTGGATACCGTCGTGGCTGCTCGTCAT
CCGCATTGCATTCTGAGTGTCAGCTTGCAAGGCTTGGCTTCTATCGTGAATACCACAGTACGTGTTTGGAAATTTTGCTCGGCGGCGATCCCTGCATGGT
CAATGCCTTTCAAGCGAGCTTGAGAGTCTCTAAGAGCTTTTTCCATGTTATGATTTTCAATGGCTTGGTTTTCGATAGAAAATTTGTAATGGTTTTTTCT
TCGTCGTAGCATTGCAGATATTCAGCACACAGCGATTGAGATATACATCAGGAAGGAAATGCTCGCGAAGATAGGAGTTGTATGATTGATCAGACCGGCA
TCTCTTGACGATTATACTGGTGTTACAAATCTTTCATCCAGACCTTGCCAAACCCTACGAAAGAATCTGCTTATTTCCAAGCCAGCCGCAAGAAGCTTCA
AAGGGATTGCAACACATATACTACTGTCGGATAGACACGTCCTGGTCTCATCCCCTTACTCCTTGTTCGAATACCATAACCATACTTGGTCCACCCATTT
CCGAAGCGTCCGAGACCATGCAATGTTCAACATTTTCTCATCCTCTTTCGGACAATCCAAGGTCATCTAAAAATTGTCCCATATACTCAGAGAAACCGTA
CACGCACGTGGACATGCTGCCGCATTGGTCTGTATGGCGAAGGATATGCTCGCTGAATGGATTGGTAGCCAGGAGTACACCGCTTGGAACCCCTCTCACT
GCATTTTATCGACGGATAAGTATTGGCTAGCACCGAAGACTCATCAGTGGAACGCATGCTGATGGTGAGGGACAGCAATCATCAGTTATCAAATTACAAG
TTGTGCGCAACGCATACCTGGAAGATACGTGCGTGATGGACATGGCTTCCTTATGTCTGGCAAGACTATTGAGTCATTCAGACGAGCAATTGCATTTCCT
TGACTTACTGAAACGTGGACGAATGCAGATTGCTTCGAGCAACCTGTGATCAAAGTACATCGAAGCCTGCTTATAGTCAAACTGACCATGGGCCGAAGAA
GTAGAATCGTGTGCATTCGTGGAGAGTACTATCACGGGGAATCAACGTGCGCTCCAATTTACGCTAAATATCGGAGTTTAACAAATGGAGGGTGCTCCAT
CCAGACCGAAGTCGATGGAGATTTGAATGCGCAGATCATAGAATGGCTGAAGAAGTCTGAACACATTGCATGTGGACTCATTCACAATGACCCGGTGGTT
TTTCGCCAAAGGATTGGACCGAATCACATACGATTTCTGCGATGCAGGCAGTCGGCTATCTGAGCATCATTTTTACGCGATTCGCGATGTTGGGCACATG
TTAGCATTCCTCATGTACGAGTAGCGACTCCGATACTTCACCCAGCTAGTCATCCACCTCGTCTCAGCAGATCAGAATGGTTGGGGTTTCACAATCCTTC
ATTTACGATCGACGTCATCAAAGTAACATGGTTGCCAAGGTCATGTTTACTTTCGCAAATGTATCAGCAGTTTGGCCCGCCTCCATATTTCCGAATCTAG
TATCCCAACGCGAATGCCCGGTCACTTATTGCCTGCACAGTGTTCAGCTAATCCGCCACTTGAAATGATTCGTACTTGGAGATCGCGATGAAGAATGGCT
ATATCTTACTCGAACAAAGCAATTGCAATAGTCCACTTTTATCTCACTCTGCTCATATGGAATCATTCTTCAAAGACACACTCACGAATCTCAGTATCGA
AAGCTGCTTTCGCACCTTCCGCATCTATACCAGATTCAAGTGAGAAAGAGCAAACGCGATGACGATTTGGATCGGTTACGCTGCAAATTCGGAGCGATGG
AGCGCTCAAACGCAGAAAGGATACCAAACTAAAGATCAAGGCAAACGATAAGATAAAGACTCGCTCCCACCGCTGAACTCGAGGATGTACAAGATCAGGT
AGACTCAGTCCTCACCAGCTCTACTCAGCATTACTTCGTGACCCTTAGGAGGATCCAATCGATACAGTCGTGTGGCTGCCGCTTTAGCGATGGCGCTAAT
CGGAAAAGAGGTATTTCAACGCAGCTTGGATAACAGTCAGCAAGTTTAAAGCCTTGAATCATCAAGCAGTAGCGTCACGAATACAACCGAAATTCAGATT
CTGCGTGTCGCGCAATCAATGGCGTTAAAACGCCGACACACATGTAAGTGCAGCTCATTGTCGTCATAATTAGCGTACATTGGGGATGCACATTAGTGCG
CGGTTCAAACATTACCGCCGCGCTCGTAATTTAAGTAAATCAGTTGCACTCTTGAAGCATTTCGTGCTTCATCAAATTGGACGAAGCGTATTCGAGAGCG
GAAATTGATTCCGAACGCAGCACTTGTACGGTGAGATTCTCCGCTATAGAGGAGTTGGTAGAGGCAAGTCTTACGATTATAGAGAAACTTGTTGAGCTCA
GCAGATCAGTTATTTTCAATATTTCAAGCATGTATGATTTTCCCACGCTCTCTTTTACTTTAAACTTGAGTCAACTATGGCCCGCGTGGCATGAAAATTT
CCTTCTTGGATTTCAAACAATATGTTTTGGGAGTGCATGCCTCACGCTTATACAAGATTCAAGTGAGGAAGAAAAGACTGCAGTCGAGCAAGTCAATGTT
CCATGATTCCATGCTTGCTACCAAGCCAAAAGCATTCATCGAATCACCCATTTTTGTTTCGCATCTGTACTTGTATTCTAGAAG