Description :
From Genome Similarity Track
Location :
Scaffold_369:18743- 19898
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_369-fgenesh-gene-0.6Heat shock protein 70
Pytiw_DAOMBR242034maker-piw_contig_369-snap-gene-0.10NAD-specific glutamate dehydrogenase

Sequence
1155 bases(100 bases per row)
GCCTCAATGCGCACCTTGTTCGACTCGTCCTCAGCCTTGTACTTCTCAGCCTCGGCAACCATGCGGTCAATGTCGGCCTGGGACAGGCGACCCTTGTCGT
TGGTGATAGTGATCTTGTTCTCCTTGCCCGTCGACTTTTCGACAGCAGACACGTTCAGAATACCGTTGGCGTCAATGTCGAAAGTCACATCAATCTGTGG
CACACCACGCGGCATGGGCGGGATGCCGTCGAGGTTGAACTTGCCGAGAAGGTTGTTGTCACGAGTCATCGAACGCTCGCCCTCGAACACCTGGATGAGC
ACACCCGGCTGGTTGTCGGCGTACGTCGAGAACGTCTGCGACTTCTTGGTTGGCACGGTCGTGTTACGCGAGATGAGCGTCGTCATGACACCGCCGGCCG
TCTCGAGACCGAGCGACAGAGGAGTCACATCCAACAGAAGCAGGTCCTGGAGCTTCTCCGACTGGTCGTTGCCCGAAAGGATAGCGGCCTGCACAGTGGC
ACCGAACGCAACGGCCTCATCAGGGTTGATGGCCTTGCACGGCTCCTTGCCGTTGAAGAAGTCCGAGAGGAGCTGCTGCACCTTAGGGATACGCGTCGAG
CCGCCGACCAGCACCACCTCGTGCACCTGCGACTTGGAGAGCTTCGAGTCACGAAGCACCTTCTCGACAGGGTCCATGGTCTTGCGGAAGTAGTCACCGC
ACATGTCCTCGAAACGGGCACGCGTGATCGTCGAGTTGAAGTCAACACCGTCGAAAAGCGAGTCAATCTCAATGTACGCCTGGGCCGAGGACGAGAGCGT
ACGCTTAGCGCGCTCACACGCGGTACGCAGGCGACGAAGCGCGCGCTGGTTGGACGTGATGTCCTTGCGGTGCTTGCGCTTGAACTCGCCGACGAAGTGG
TCCACGAGACGGTTGTCAAAGTCTTCACCGCCCAAGTGCGTGTCACCGGCCGTGGCCTTGACCTCGAAGATGCCCTCCTCAATGCTCAGGAGCGACACGT
CGAAGGTGCCGCCACCAAGGTCGAAGATGAGCACGTTGCGCTCGCCGCCCTTCTTGTCAAGGCCGTAGGCGATAGCAGCGGCGGTCGGCTCGTTAATGAT
ACGGAGCACGTTGAGCCCCGCGATGGCGCCGGCGTCCTTGGTCGCCTGGCGCTGC