Description :
From Genome Similarity Track
Location :
Scaffold_50:187423- 194156
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15574hypothetical protein
Phypa_INRA-310PPTG_15575heat shock protein 101

Sequence
6733 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTGGTATCTAATACAAACTATAAGTTAC
CTATACTGAATCTAGGTAGATATGCAATGATTGGCTCCTAGAGCCCCTGGTACCATGTACCAGGTCTCTCAAGAGTGACTGGGCACTCTTCATGTAACTT
GGGTACACTTGGGGTATTGTACCCCGTTACAATCTGTGACAAAAAAGTAAATTGAAAATAAGATAAATGTGTCTCTGTTGTAAATTCTCTGGATATTTAA
ATCCAGAGTTTTAGGGGCGATCGGAAAGCGTCGACGATCCTGTCAAATAACATTTTTATGGATGTAATTATTTGAAACCTAAGAGCGAATATTTATAAGC
TAAAATGACGCAGAAACTAATAAACTGTTTTCTTGTTTGCCCAAACGGGTGAATGTTGACCCAGTCGGCCTAAAACAACATTCAAACAACCTTGTACGAA
TGTGATTCAGTCACATTCAAGCTACCTTATGGCTTCAACTTAGGGACGGAGCAGTTAGTAAATATAATCACACAAATGTCATGCGTCCAGCTTCAGATAT
ACATGCATCTCAATGCAGCACATGTACCCAACACTGGGATACGTTTGAAATTGATTTAGAGACGGCAAACATCAAATTCTCAACTAAGAAAAGTAAAAAG
TCCCAGTGTCGCTGGCGAAGTGGGGGCCCATCCTTATTCGCGCTTCAGTTTCTTCCTATTGACAAATATTATAATATTAAATATTGAGTATCCAAATATC
CAGCGCTTCCCGGGTGCAGCACGGCATTAGTTACAACAGAGACACATTTATCTGTGCCAATCCCAAAACTATATATGAGGCACCATTATTGTAGTTGCTG
TTTAAAATTATTGTAGATACATTTATTTTTAAAAATGCATTTACAATAATTCTATTTTTTGAAATGACCTCGAGTGGGAGGAGGGCAAAAAATGAACCCA
CGTCCAGGATGCCCATTTGCCCAGAGGGTGGAACATCATCGAACTGACCAGTACCCAAATCAGACATCTTAAATCGTCGCTTTTAAATCCACCCGCAATA
CACTTTCTAATTAATTTCACTCGTAATTCTGCATCTAAAACGCTGTCCAACCATGCGACATGGATTACGCCATCTACCCTTTTTCCCAATTGCGTGACCC
ATTTCATTAAACGTTCAATCCATTTCAAGTCCGCCCGCATCATCAGTATCAAAACGAACCCTCGAACCACACAACACGATGCCAAGGTTCTGTGCTGAGT
GTGGCGCCCAGAACACAGGCGGCAAGTTCTGCTCCGAGTGTGGCACGCGCTTCGCCGACGACAATGGCTCGCTGTCCTCCTCCTTCATGTCAAATTCCTC
CGGCCCTCCCCCCGCTGTGCCAGTGGCCGCGTATCAAGGAGCTGCCACAGCCGTCGCGTCGGCCTTCCGCAGTGATAATTCGCCCTATGGAGGCAACACG
TACCAGCACAACCCCCTCAAGAGCACCTTCAACGGGTCTCCGTCACAGCCTCCGCCCCCGCCCCCTCCTGCCCAGCCGTACGTGCGCAAATCGGTGCCCA
GCGCCTTCCGCAACAGCTTCAACAACAACAATTCGCCTCCTGCTGCTATTCCCGTGGCCTCAGACCCTGTACCCCCCGCAGCTACGGGCGCAGAGGCTCA
GCAATACTACGAGAGATGTGTAAGCACCATCCGAGCCTCAAAGGGGGGAAATAACGAGCAGGGCGTCAAGAACTTTAAGCAAAACTGCCGTAGATACGGA
CTCAAGGAGATGGACGTCCAGTCTTTCTATGCGTCGCTGGTAGTGGAGCTGGGGCCTGAAGGCACGCGCAGCTTCGTGCCGACACTAGCGAGACTGGTAC
CTGACGACGATCGACGGAAGGAGCTCGTGGATTATAACGCGCAACAGCGAGCGTCTGCCTTTAGTAGCAGTGGCAGTAGCACGGGCAGTCTCGATGGCAG
ACAATCGGCTTTTGCCAACAGAAACCCAAGCATGGCTGACTCGTTTCGCAGCGACTCGACTATGAGCAGCGCCAATGGCTCACAAAGCAAAGGAATCTTG
AACAACCGCTATGCGGACCACCCGAACTGCGACGTGTGCAATGTCCGCTTTGATGTGACCAAAAGACGACACCAATGGTACGAAAAACAATTATGGTATG
CGAATTTTATTTTATGATTACTAATATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAGC
AATATTGCAAACTCGCCCTGTTTTACAGGTACAGTCCTAAAAAAAAGGGGTAAGTTTTCAATATAACGTTCTTTTCAATCGAACAGATCCACTAAAAAAA
ATGCTGCAAAACTGTTTGAACGTACCTTATTGGCTTTCGCGAATATTCTGGAACGTGATTGGCTCCAACTCCACGAGTATCTATTTCTCTTCAACCGACT
TCAGTTTGCAACTTGCCGTCAAGCACATTCAACTCGAAAGACCAACACTCTGAGCATGCTAGCGCTATCCCGCGCCGTAGTGGGTCGCCACGTGCCGCTG
CGCACGCCATCTCCCGCTCTGTATCTCGCACGCCGCGGCTTGGCCTCTATGGGTCAGCCACAGACGTGGATCAACCCGCAGAACGTGCCGCAGGGGAGAG
TCTCAGGAAATACGGTCGCGATCTGACAGAAATCGCCAAGGCCGGCAACTTGGACCCTGTGATTGGCCGCGAGGACTCAATCCGCCGCGCCACGCAGATC
TTATCGCGTCGCACCAAGAACAACCCGATTCTGATCGGAGAGCCGGGCGTAGGCAAGACGGCAGTGGCCGAGGGCCTCGCACAGCGCATCGCACTGGGCG
AAGTGCCCGACAGCCTCAAGGACAAGAAAGTCGTGGCTCTAGACTTGGCCGCGCTCGTGGCTGGTGCCAAATTCCGAGGCGAGTTCGAAGAGCGACTCAA
AGCCGTGTTGAAAGACGTGGACGAGAGTGATGGTAACGTGATTTTATTCATCGACGAGCTGCACACTCTGGTAGGAGCTGGAGGCAACGAAGGATCCACC
GACGCCGCCAATATGCTGAAGCCAGCGCTAGCCAGAGGCGCGCTGCACTGTATGGGCGCCACCACGTTGGACGAGTACAGGAAATACATTGAAAAAGACG
CCGCGCTGGCCAGAAGGTTCCAGCCAGTGTTAATCTCCGAGCCCAGTGTGGAAGACACGATCACGATTCTGCGTGGACTGAAGGAGAAGTACGAAGTGCA
TCACGGCGTGAGAATCGCCGACAGCGCGCTCGTGGCGGCTGCTACGTTGGCGAACAGATACCTGACGGAGAGGAAGATGCCGGATAAGGCCATTGACTTG
ATGGACGAGGCGGCGTCGAGACTGCGACTGCAACAGGAGAGCAAACCGGAGCCCATTGAGAAGCTGGACCGTGAGATTATCCTGCGTCGTATCGAGATTG
AAGCTCTGCGGAAAGAGACCGACGCGGCGTCGAAGAAGCGCATGGCTGCGTTGGAAGAAGAAGTGAAGAAGGCGACGCAGGAATTGAACGAGTTGATGGA
CGAGTGGAACGCGGAGAAACACAAACTGGAGGAGATGCAGGACGCCAAGCGCAAGCTGGAAGAAGCTCGACGGGACTTGGTAGCAGCGCAGAATGCTGGT
AATTACTCCAAGGCAGGAGAGTTGATGCACTCTGTGATCCCCAAGCTGGAAGCCGAGGTGGCTCATGACGAGCAAGAGGAAGAGGAGAGCAAGAAGTCGG
GAAAGAGCAGAACTTCACTCGGAGATGCTGTCA