Description :
From Genome Similarity Track
Location :
Scaffold_17:18740- 21161
Transcript NameFunction/comments
Phyci_4198Hypothetical protein

Sequence
2421 bases(100 bases per row)
GTGCTCGCACTTCTCCAGCACACCCTTCTGCAGGTAGATCTTGCTCACGCCCATTTGGTACTCCTCGGGCATCTCGAGCTTGAACTTCTTGACCAAGATG
CGGCAGTGGGCCTCGCCGTACTGCTCTGGGTCCTCCTTCTGGCGGATCTGCTCCTGCTCGGTGAGGAAGATGTCGAACTGCTCGGCGAACTCGGCGTGCA
GCAGTCTGTTCGGGTAGCCGGCACGCGCGATGCAAATGGCTTCGATGACACCTGCGCAGCGAAGCTGGTTGGCGACCATCTTGTCCTCCAGCAGCGTGGA
GCTCTTGGCACTGTTCGGCTTGATGCACCGAATGTAGTTGACGTTCGTCTCGTTGATGTTGGTCATGAGCGAGTTCAGAGACTGCTTGAACTGCATGCCC
ACAGTCTTGTCGCCTCCAGCCCCGCCTGCACCTCCGCGAGCACCTCGACCTCCAGAAGTCGAACGCTTCAAGGTGGCAGCGGAAGCTGCAGCCGCAGCCT
CAATCTCGGCCCTGACCTTGAAGAGCATCTGTGGGAACGCCTCGTGACTGCCGCACATGAGGTCTGACAAGTCCGAAAGCAGTGCGTCCTTGTGCTTCTC
CAGGAACCCCATGGCCTCGTACTTGACAGTTCCGGCATAGTGGTGAATGGCGAACTGGGTCTTGGAGATCCGCGGGAACTCAATGAGGTTCTTCTGCTTG
AGGTAGGCACCCGATAGTTTACTGACAAAGCCTTCCTCGTTGCCTCGTGGGCGGACGATCTCCTCGTTCAGCAACGCCAGCACGCCCATACGACCTTCGA
TGAGCGCAAGCGTGTCGCTGTTGTCAGCGTACGAAATGTGAGCCCACGTGATCTTCTCGCGCTcgtactcctcctgcaccgccttgaaaacgtcctgagt
gaacttctgctgcagcttttcattggcgtagttgatgcagagctgctcgaacgagttgaactcgaaagtctcaaagccgaagatatcaagcacgccaatC
GTGTTGGCGGTGAGTCGAGGTGCGGCTCCCAGACTAGCGTTGATACCAGCCACAAGCCAGTCGAAAATGCTGGCGTAGATGGCCTTGGCGAGAGCATCAC
GTCCCGACTGGGCCTGCTCCACCGTAAGAGGAACCAGATATACTTCTCCGGCAGCCTTCATAGTACGATGAGTCAGGGCTTTGCCCATAGTGTCCGGGTC
CAAGCCCAGCAGAACGCACGAATAAATCACGGAATCCTTGTCCAGGTCGCAAGCTTCGTCGTTATCCGGCTGCGCGACGAATCGAGCCTCACCCAGATGC
AGAATGCCCGACAGAACCTGAAACAAATCGTTTTGCTGGTCGGGGCTGAGTCCAAGCAGCGAAAGGGCTTGCTTTGTCTTGGAAAATAGTGCTCGATCTT
TGGCATTCTCAGCCTCGATCATTGACACTGACTTGGGAGGAGGTGGCGCACTGGGCCTCGACTTTCTCCCTGGCCGTACCTCCAGTCGAGGCTCCTTCTC
TTCGAGGTACGAAAACTTAGGGCATTCAGCGCCAAGTCCCAGTGCGTCGCGTTCCTCGTCAGTTGTGCCGTGcagaagctgatagaaaatgtggtagttg
cgctcaccgcgttcgtgggagataacacgagtcttctcgagcagatacgtctcgcactgggcaccgcacagggcgtggtttttgtcaaactgaagctgag
tgaacttgccgaagcgactggaattatcgttgcgagtggtcttggcattaccgaaactctcgagcagcgggttCACTTCGATGATACGCGTGGTAATGCT
GTGCTCCTGGTCACTGGCAGTCGCGGTCGGTGCCGGAGCAATGGTGGCCAGATTGTCCATCAGGATCTTGGTGGTCTCGGTCTTTCCAGCGCCGGACTCG
CCGCTCACGAGAATACTCTGGTTGCTGCCATTATCGCACATATGCCTGAACGCAGCAACAGACACCGCATACACGTGCGGCGGAAGGTCTTGTCGCTTCC
GAGCCTGCAGGTACTTCTTGTGGAGTCCTGGTGTGTACAGCTCGTCcagccactggtacgggttcactgccagacaaatgtcgcccgtgtacgtgtacgg
cTTCCGTGCTCGGAAGCGCTTCTTGAGGTTACGCAGAATAGCAGCCTCGTGCAGGTGGTTGAGGTCGATCATGTTGTCCAGCCCCTCGTCGTAGCGCGAA
AGCTGCGCGTTTTGCAGGGGGAAGCCGACGTCCATGGGCACGACGCGACTCTCTCCAGATCTGTCTGCATCGTCATGATCCACCGTGTCCTCGTCCTGCT
GGTCCTTTCGTGGCCTCTGGATCCTCACGGTCACGAGCCCCTTTTGCTCGTTCACCTCCTCGACGTACACGGGCAGCCACGCAGAGTCGTCGTCCGGAAT
GTAGCACCGAGCCCCCACCGC