Description :
From Genome Similarity Track
Location :
Scaffold_57:18740- 20122
Transcript NameFunction/comments
Phyci_228779CTR-like PK
Phyci_93734conserved hypothetical protein
Phyci_93735unnamed protein product putative

Sequence
1382 bases(100 bases per row)
AACTATCTCCTAATCCAGCTCTTGTGTTGCATTCTGTCAGGAATTAATGAAGCAATGCTGGGACGGTGAACCAAGCTGCCGCCCAACTTTCGAAGAAGTG
TATGAAACCTTACAGGGCGTATCCTTTGCAAGGTCTTTCGAGGCCTCTCAGAACGTCTTCGAAGGCGACGCGCTCGATTGTTTACTCAACAGCAAGTAGC
TGCATCGAACTCTTGACTTCACGCGTACTTCTGCTCCAGCTCACTGTAGCTAAGTAATAGACCGCAACTTGACTTGCTTCAATTATGCCGTGTCCTTGAC
CCACTGGTCCAGCCCCAGGTCGTTCCAGCGATCCACCTTCTCGTCGGCAGCCCACATCGGCGGTTCACCTGTGTGAACATTTCAAAGAAGTTGGTAAAAT
AAAAACAAAGACGAAGTATAACCAATGTCAATGAAAAATTACCAACCGGTGGGGCTTTCACTGCCGTTCGGATCGACATCTAGAGCAGGCGGCACTTCGA
TCTCTGCTCGACAGCGAAATTGAGTGTAAAATCCACAATACTGGATATGTCAATTCCGACATCTTTACCATCGTCCGACAGCGCGTCCGTGATCCAGGCG
TCGTCCACGATATCCAGGTAGTGCCTGCGCGGGAACAAACTCGGCAGCTTGCTGTCCTGTTCACACCGAAGGTTCCACTTTCAAACTCAGTCATCACCGC
TAAAAAATCCACAGATTCCGAAGCACACAGCATACCATTTCGCCTTGCGCAGGAAGTTTCGATATGTTATAAAGCACACCTATCATTTCTGACAATTTCT
TATTTTGGGCTAAAACAACGTCCACCCTCACTCACAAAAGTATCAGAACCCAAAATAAACTGCAAGCTACGGTTGACCACCATTACCAGTTTGATGGCGT
CCCGAGCAGGTCAACAGCAGCGCAGGCCCCGGCGAGGCGGCAAAACTCGCCCCTCCGGGCGCCGAGATGATCCTCCCGAAGTTCGTTTGTCCAAGACATT
GGCTTACGCTTTGCGTCACGGGGCGGAGGAGTTGGGACTTGACATGAGACCGTCGGGTTTCGTGTCATTGACCCAATTGCTGGCCCTGCCACTGTTTCAG
TCCTTCACGGAGCAGCAGGTGGACGAGGTGGTGCGCACCAACGCCAAGAAGAGGTTCTCCATCACAACGGACGTGTCGGGGGCCGTGAAGTTCATCCGAG
CCAACCAGGGTCACACCCTGCAGTTGGTTCAAGACGAGGAGCTGCTGACCCCGTTAGAGGACCCGAACGCCATAGACAAGTGCGTGCACGGCACGTACCT
CAAGTTCTGGGACAGCATCTGGAGCTCGGGGCTGTCCAAGATGCAGCGGAACCACATCCACTTCGCCGAGAGGGAGGTCATG