Description :
From Genome Similarity Track
Location :
Scaffold_799:1874- 9622
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_799-snap-gene-0.4Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_799-snap-gene-0.8Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_799-snap-gene-0.9Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_799-snap-gene-0.10Conserved gene of unknown function

Sequence
7748 bases(100 bases per row)
CAGGCTTCGTCCAGGAGCGCGTGCACTCGACCGTCATCGGAGTGGAAGCCACGGCAGCTTTCCTCCAGCAGCTCATTCAGGAGCTGGAGGATGCCACTGC
TGAGTATCTCTGCTTTGGCATCCAGGTAATCGAACACGAGCAGGAGGTCGAGCTCGGGACGCTCATCACGGCGGCGTCCTTGGTGAGTCAAACAAATTGC
ATCGGCTTCTTGATGCGCTCGCTACTCCACTTTTTGACTCACTTGATGGCCATGTGGCTGCTCTCTCAATGCAAATGATTGGATTGTATGGTAGAGCGTG
CGCTACGTGACTGAGTGCGACGCGATGTTGCCGCTCCTGAGCCGCTTTCGCGCTGCTTTCTCGACGGTTCTGCACTTTGACGCATGGGGAAAAGCGTTCC
TTGGGCTGAAGGTAATCAATCACGCACATCGATGCTTACCATTATTATTGGTGCCAGGGACACTGACGATTGATGACTCCCCCGCTCTCTCTGTCTCATA
TATCTCGCTTAGACGGTGGCTCTGATGGCGTCGACGCGCGTCCTCGAAGCTTTTGGCGCTCAAGTCGATGCTGAAGACGTCGAGCAGGAGCTCAAGTGGC
TCGTGGAGCTCTTCGTGCCGCCTGAGGAGGACGAGAATCAGTGGCTCCTAGACCTCTTCGCGCCGCAGGACGCCGAGCTTTCGGTACAGAAGGCCGATTA
TTTGCTTCGTCCGACCTGCGAGTACGTCTCGGTCGCTTCGCAGACCCACGAGAGCGCGCGAGACACGATCTACTCCAAGACTCTGCCACAGCTGCTGACG
CTTGTGCAGCGCTTTGGAGATGAGTACTCCGGTGAAATCACTGTCAGTGACGCGACGCTGAACGAACTGGTGTCGATGATCGCCGTTCTCCTGGAAGAGA
AGCTGCCGCGTCCTGCTTCGAATGTGTTCACATTGCTCCCAGTGCCGTTGTTCGTGGAAGAAAACTCCTCATCCGACGTGCTTGCTGCCACGAAAAGCAC
GAACGAAGACGGTGACGACGAAGAAGTAGATGATGAATCGCCATTGAAGTTCTCCAATGGCGACAGCTCGCTCTACCAGTGCGTTGCAACGCTCTGCGGC
TGGCTCAACACTGCGGGACGCAGAACGTCGGCTGCGGTCGTATTGCCAGACCTGTGTCACTCAATCTACTTGAACGACCCGGAGCAGAACAACACGGACA
TGGTCGCGACTATCCTTGAGGCGATAGTTTCGAGGTAGATACCAAGCAGAGTGCTTCCTGATGATCTCTGCTGTTGTATCACTGACATCAATGCTCTTTG
GTTGCTGATTTCTCTCTCTCTAGCTTACGCGAGCTTGAATTGAAGACGGTGCTGGATTTCGAATACGCGAACACGCTGTTGGAGTCGCTGCGCGACCTTA
ACTTGCGCGTCCCGCACTTCAAGGCTGGCTTGGTGTCCATGGTCTACAACGAACTGCGCGCGGTGATGCCGCGTCTCGAGGTGAGTTCATGTGGTTCTTG
AAAAATGGACTCACCTGTTCTTCAGCTCACTTAAATCTTGTTGCTGTCATTCTATATCACCAGAGCGCGATCAAATCGTCGAACGCTGAGAAGGAGGAGC
TCCAGTCGATCAAGTCCACGTGCTCCAAGGTCCGCCAGACGCTCGTGGAAGCGTTCGTCGCGTGGATCTACAACGCTGGTGCTTCGAACTTCGTGACGCA
CCAAGCGGACTTTTTGGGCGAGACGTCGACCAAGCTCGCTGATCCTCGCATCTACGGAGACGTGATCCACGTCGTGCGCAAGGGCGTGGGGGCCGATGTG
CCAGAGACGGAGTTGGTGTCACTGGTGGAAAAGTGCGCTCTCTTGCTCATTCAGGCACTGAAGCAGCTCGACCGATACTCCAAGGTAAGTCAGTCAGTGC
ATGAAGCATATAGACATTCACCGTTTTCTTGTGAGGCTAACATTCGGTCCTTGCGTTTCGTTCCTTTTCCCCATAGACCACGGCAAAGCAGATTGTCTCT
GCTGTCACTCGCGTTGCCAGTGCCAGCGGGAAGTTTGTGGCTCCATTCGTGGACGACCTTACGTCGCCTCTCCTGGTCTCCATTGTGGATGGCTCCTGCA
AGGGAAAGACTCTTCGCGCCAGACTTGAAGCAGTGACGTGTATTGTGCTCGGAGGCGTGGAGGATGAAGCGTTCAAGGTTGACTCTCACCCGTGGATCGC
CCAGTACGCTGGTGTTCTCCTCGATGAGGCGGAAGCCGAGAGTGCCCACACCCTGGCGATTATTGCCAGCTTGGTGCGTGCATCGCCACTCTTGTTGCAG
CAGATTGCGGCTGTTTGCACTCAGAAAACCCTGATCGTCGGACAGATCTTCCACGACTCGCTCTCTCGCTGGCCATTGTTTGAAGAAGACGTTGACAGCG
TCATTTTGACACTCGAGATCCTCCAGGCGCTGCTTGACGACACCTCGTTCCGCGCGCTGCTCGATCCAGTAACGATCGCGTCGACCGTCCAGAAGCTTTC
CGAGAATGCGTCGGGCGACGATCTTGAACTTGTCGTTGCCGCTTGTAGCGAGGTACTTGCGTCAGATTTCCTTGAAACTAAGCAGTGAGCTGTGCCACTG
TAGCTTCCATACATACAAATACACTTGAGGACAATTTCCTCGACAACCGATGTCCGTTCCTACTTGTGTGCTTCGCTATTGCTGCAACTGCAGTGAGGGT
ACAATCAATTCGCCATGTGCGTTCCACTTACACACGTTCCAGTAGAAACTGGATCGCCATTGCTCTTCGCTGGTCTGGGAACTCTCGTACACGAGCCCAT
CGCTCGTGAAAATCTGCACGCGCGGTTGATGAAGCGCTGCCGCACAGCTCGGATGGAGAGATGAAGCGACCTTGCAGCGGTACGAGAAGCCTAGAAACCA
GGACCAGCATAAAGAGAGTGAGTGGAAGTGCTGCATTCACATATCGAACCCCGCAAGCTCTTGCAAATAATTAATACCTTTGGCACAGGTCAGCATGAAC
GTGTGGAACTCACAATCGCCAACTTGTCCGATATGCTCTAGCTTGACTTGGTCTTCGTAGGCGTCGGGGTGTTGACGCCAGACATGGCCCACTGACACCT
TCGCACAGTCCACAAACCAACCATTTCCATATATGTCAGCTCACAGTTCAAGACGAGATATACTTCAGTCTGCGTTGTTCTTACCTCATCCTTGAAAATC
TCAATCATCGCGTCCATTGGCTTGGCCGCATTCACATAGGAAAAGACGATCCGGTAGACATCGCTCTGCTTGATCACTGGACACATCACTGCGAGATATC
GAGTGTTGGACTTGGATGTGTCCCATCCTACCTGAAGACTCAAGTGAGTCGTGAAAAAGCTGCCAAAGCTGATCTCCACGTCGTATCCCCCGAGCCGCAA
CGGGATTTTCGACGAGCTCCCAATCGCCAGCATGTGGTCGACTCGACCTGTTACGTCGGCTTGTGGATCACCAAAAGCCGACTCGCTGCGGTCTCCATCT
TGATTCGCCACCTCTTGCTCTTCTTTTCTAAAGCGCACCTTTGCGAGCGCTGGGCACTCCGTCATGCTCTCCATTGACACTGCTGATACGAGAGCAAACT
CGATCGTGAGTTTACCTATTAGCACGGGAACGAAAATCGTTTTCGCGGGGCGATACCGTCCACCGTCCACAACGACATTCTTCGAGGCCGAGTACAAAAT
GCAGGTGCATTCCTTCAACGCGCTCACAGAGTAGAGTCCCTTGCCGACTTCCCAAGTCGCACAACCTCGCGCATCGGTCTTGACGATGTACCGCTGCGAA
CTGCACTTGTCCACGACTTGGATCGGAATGTCAGCGACCCTTTTTAGATTGTGCTGGTGGTAGAAATCGACCAGCTGAATCTTGTACGTCCACCGATATG
CTTCCAGTGGGACCAGAATCTCTTGCGCTGTCGAGCAGGAGGTGCCTGTGCTGCCCTGAGAACCAGAGTTAGTTGCGCTCGGAAAGACGACGACTAACGA
TGTCCACTCAAAGTACTCCAGATGGAAAATGTACAAAGAGTATGACCCCGGTGTTAGTCGGCAGCTTATCTTCCCTTCGCTGTCACTGACGTAACAGAAT
TTGCATTCCCGCGCTCTCTCGAGCGAAACCTGGAGCGCATCATTTGGATCAGGACGCCCCTTTGCGTTCTTCTGTGCAGGCGGCGAGTTCTCGTCTTTAG
TATCGCCGTCATCCGACTCTGTTGGTGTAGAGGCTGAAGGATTACCACCATCTTGTTCTTTACCATTCTGCTGCGCGCGCCATATTTCGTAAACGCTCCT
CGTGTCCTCCGCCCGGTCAAGAGATCTATTCGCCAAAAACAGTCTGTCTTCTTTGAAAACCTCCAGCCCAAACTCGAAGAAATCTTCCAGCAAGTTTCTC
TCGCTAGATGAGAATTCGAGAGGCAGTTGGTACACCTGCTGCAGGCGAATCGGTCCATTTCGCGAGTAGATTCTACTGCGCTCGCTCTCCTTAACCTGCT
CGAGAATTCGCTGCTTGCTTGCTTCGTAACGTCGGCGCATGACTCTCTTTAGCATCGCGCGAGATCGGATATATGGGATGAGCTTCGAGTCTCGTCGCAG
TGAAAACAGCACCACTCTCATGCCGATATTGATGACTTCGTCAACAAATACTGCAGCAACAGCTTTCGTGTCATCGAGAACGCGTTTCATTTGAAGTCGT
CGTCGAATAGAGACCAGTCTGGAGCCCATGGTCAGTGTCGGCACGATTTTCTTCGCGAAGTTGGCAGTAAGCTTGATGTTGTCCAGGTTCCTCTCGATGA
ACACGTGCGCTTTCTCAACCGGCATGCTACTCTGCTCGTTGACCACGCGGATCTCCATTTGGCGCTTGTTATTTTTCTCTTGGGCGACAAACGGATTCTG
CTGCAGACTTTCTTTGATGCCATGCTCGCCAAGAATGCGTAGGATATTCCGATATACTGACTGGGTAGTCGGCAAAGATCGGCTTGAGCTTTCGTGTTGA
TACACTTCGACTTCGTCGCTCAGTCCTTGAAGCTTGAGTGAGATGACTAGCGGTGAGAGCAACCCGAAGCTTCCGCGTCGACTGCTCATCCCCTGGTTGT
CCCCACTCGGCGTCATGGGATTCAGTGAAATGCGTCCATTCCGCCCGAAGCGAATGCTCTTTGAGAAGCGCTTGGCATACTCTTCGAACTCACTGCCTTT
GTCACCGCCAAAGTTCTGGAAGCTCACGATAATCTCATAAATCTGGATGATTGCGTGGTTTACAAGCAACTCATGCATCTCATCGAGTCCTGTGTGAATC
GAGTTTGCTTGACTGGATCCTCCAAGTGCTTGCACTTTCCAATGGTGAAGCTTTTTGCTTCGGTACAGAGCTGCCAACGCGAACCAGCGGCAGTTGCTTT
CCGGAAACATGTCGACGATGCCGAGAGCTTGCAGAGTTTCCCCATTTTCAATGTGAATCCTGGCACGCAACTCCTTCTTGATACTCGACTCTGCGTCAGA
CACTGCGTTCTCCTCATAGCCAATCTTCTGGAGGCACAACAAGATGCAATAGACTCGATTTGGGACGTGGGACAGGTGGAGATTCACGCGATGCACAAAG
CCACCGTACAAGTATCTGGTTTGGTGAAGCGAAGTTGTACCATCTTGAGACACTGGACACTCTTCATGGATAAACTCGAGGAGCTGGAAGTCGTGGTCGA
GGAATATGCCGATGAAGCGCCATGGAGACTTCATGACGCTCCCCTCGCAGTCCAGCGTCGTACAAATCGAGAGCGACTCCAAAAGCGGAAGAGCGTACAT
GCCACTTGCCGTCGGAGCTAGCATGGACAACGTCGGCAGGTCTTCCATGCGACTCTGCTTCTTCATGTAGTCATCCTGAACAAATCAACGCAAACCCTTA
GCTGACATTGTAAGCTCGAGCTCGTAAGGGTAGCATACCTGAATGAATTTGAAGTGGCGAACAACGCCAGGAAGCTCCGAGTTTGCGAAATGGAAACCGA
TTTTCTGGAACATCGAGACAACTTTGCGCTCCGTGAGCACCACTTTCCGAGTGATCACAGCCTCCAGGAAAAGCCGCTCGCGATTCTGCCGAGATCGTCC
CGCTAGTGCAAGAAAATATCGAAACGCTTGCACGTGGATCTCTTCTCCAGGCGATCTGGTGAGAGAGAAAGACAAGCACGAGTGCGTGAGCTTGGTCAGT
TTGCACACAAACACACACCAAAATGTTGTTAGAAGCGTACCGCTTGGCTTCATGCAGGGTGATTGACTGGATTTTCTTCTTGATTTCGTCAGGGCTTGGG
AATAACGACGTGCTCGCCATCGAATGGAGCGGGATGGCAATCGGACCTCTCCCAGCATCTCGCGTAATAATCATGATGATCTCGAACGATCCTATGCACG
GAGATATCGGCTTTCCGTCTTCTTCATTCACAATCACAGCGAGCAGAGAGCTCAGGACTTCCAACTCACGGATGACTGCGAGCGATTTCTGCTCGTACTC
CTTCTTTGTGCGGCAACCGTGCTCACTGCCGATCTGCATGTCAAAGTCTAGCGCGTACTTGATGAGCACATGGACGTCTCCTGTCTGGATGACCGAGAGC
AGCAGATTCTCGAATGATTTTGAGGTCGCAACCGCCTTGTCGTTGTGGGAGCCGTGGAAAAAATTATCGAATAAGTCTATTCGAGATAACGAGGCGCTTG
ATTGCGGAGAATTTGCATATAATGAGTGAGATGATCTTCGACCCAATGAGCGCTCGGAGATCGGAGGAAAGTGTTTGCGCCAGAACACATTTCTGTGCGC
GTTGACAGTGTGATTGTAGTTTGAGAAATCTTTCACGCGCCCCACATCAGTGAACAGAATCTTCAAGATGATTGCGTGGTCACCGCTTTTTTTGCTGCTG
TTTGCGCTTGTCTTCACGAAATCCACATTCGATTCAGCCGACGATACGTTGTCTGTCTCTTTCAAGCCTCGGCTGCTGCTACTCAGCGCGTCTGAGACCT
TCCACATTGTCACTGATGCGATCAAGCCAATGAAGCCGATCCGCAACCGCCAATCCCGGACGCTTCGCGAGTATGACGGATGACCTCCAATGTAAATCGA
GTTCACGTTCGACGATGCTGCAGCAGCCCACATTGTCTGTCCACCACCATCTGGGTTGCCACGAGCGTTTGTAGAGCTCTTGTTTGAGACTGCGTTTCGC
GGAACTGCTGCGATGATACTCGCCGAGTCGACCAGGTTGTCGTCAACGTAGAGCCGTAGATAGTGGCAGTCAAACGTGACGTACAGGAGCACCCAGCGAT
TGCTCGGTAGCGCGTACCGGTTTGCCCAGCATTCGTACCCTTTGAACCAGACATGGCAGCCAGAGTCCAGCGAATACTGCGCTCCTTCTCCACTACCTCG
AGTCCCCACACTATTCCCTGAGCTGGTGCCACGATCGTAGATCGAAAAGCTAATTTCGTCACTTTGGTTGGGATTCGGAAGCTTTGCAGCGATGAGCTTT
GACGCAGGCATGTCTGCGGTGACACAAAGAGAAGGAGGGTCACATGTGGGTACATAACTGGACTAGAGCGATGGCATGAACGAACACACAGACTCAATAC
CTTTGTCTCGAAGTGCGGTTGAGGTACAGCTCTGTATCGTTTCCGCAGCCGAGCAGCCGTAGACGCTCGAGTCAGTGTTCCCGCAGCACGTCCAGCGCAC
AAACTCACCGGAGTCGTCAAGTTCAGGGTGTGTATGCCGAGATTCTTC