Description :
From Genome Similarity Track
Location :
Scaffold_441:1874- 6082
Sequence
4208 bases(100 bases per row)
CGAGAAAACGTCGACTCCCAGTAGGTGCGGGGCACCCTAGTGGGGAGGAACTAGACTTTGTAAAGGCTCTAGGAGGTAGAGATGAACAGGGCTTATCCCC
ACACGATATCGTGGACGTTGCCACAAACTGTAAATACAAGTCAGGCTTGTTGGTTACCTCGGCAACGGTTAAGGGCTTTGAATACACGTGGTCAATTTTG
ATTGACTCTGGGGAATCGGTCAACTACGTCCGACGCCGATCCCTTGAAGAAAGTCAGCAGTATACTGAAGCGCTGAAAAGCGCATGAAGTGATGTTATCA
CGGTGCATCTAGCAACGGGGGCTCGTGTCACCGTACCTGAAGTTCCGTTGAACTTAGGTGTAAAGTTTTTAGACTGTAATATAATTGAACGCTGTCTTGT
CCTAGATTTGAACTCGAGATATGATCTCATTTTCGGTATGGTCTGGCTGGAACGCCACGAGCTATGGATTGATTGGGGGTCCAAGACCTTAGGCGCGACG
CGCAATGTTTCTAGTGAAGCTTTGGAGAGTCATGAATCCACCTTTGCTAGAAAACCGTGGCGCTATTAGCGCGAGCCACTGACTGAGTCAGTTAGTGTGC
TGGACATCGAAATGTCTGAGTTAGTTGAATCTGATGTCAATGACAATAGCGAAACGGCACGTACTCCGTGAGTGGCACTTGTTGTTACAACGAACCACTG
GATGCCGATAGCATTGATGACCCCAGGTCGAGTCATCTAGGAAGTGATCTCTTAAATATATGTGCAGTGGCACGTTAATATCCACATAGTGAGGGCGGCT
GCAATAGCACCTCACTGAATGTCGGTCCTGATATTGTTGGCGAAACGCCCCGGTACCTAGAGAGAGGCTACTTTGATGCATGTGCAGTGGCATGTGAACA
CCCACAGATTGAGGGCGGCTGTCTTAGTACCCTTACTGAATGCCGGGAATGGCGTTTGGCGAGACGCCTAGAAATCAAGAGTCTGATGTGCGCACAGTGG
CGGATAACTCGCCAGGTAATGAGTTCGAATTAAGTAACTCTGCACCGGATGTCGGTAATGACATCAGCTCTTGTATAGAGCACGCTAAGGTTATATATAA
GCTAATCACCATGTAGTACCAGATATTCCGCCCTTGCTGAGGAATTCAGTCTCTTTTCAGAGACGGCAGCAACGCCAGATGGCTGCTGCGAGACGTAAAG
CGTCTGTAATGTTGCTAAGCGATACTAGCGATCAGCCATTTACACTGGTCGATGGCGTGACAGGTCACGTGGATGGTGAAGTCGGCCTTGCAGCCCTCCC
ATCGTTAACTGCTATGTTTGAGCTAGACGAAATGTCTGTGGATGAGTTCAGTCAGGCCTTGAAGGCAGGCGAATGATTCGATATGGTGATCCTTAGACCC
AATAATGAGTTGAACTCCTCTTTCCTCCTGGATGAGACGTTACTTGAAGGTACAAAGACGGAACTTAGTGCACGTAGTGGGTCATCCATTTTAAAAAACC
TTTCAGATCCCTACTATCCTTTGATTTAAGGAATTTCAAGACGTGGTATGTCATAATCCGCCGTCTAAATTACTTCCCGATAGGGACGTTCGTCATAAAA
ATTGACTTGGTTCCTGGAACCAAATACTGCGTTACGCGGCAGTGTCCTTTACCGAAGGAACAGTGTGACGTCATTGACCAGTCTTTCAGTGCTAAGCACG
CGGCGGGAATGGTGCGCGAGAGTAAGTCTCCTCATTTCACACCGACATTTTGTGTCAAAAAGCCTAATGGTAAATGGCGTATTGTGCATGCTTACAATAA
GCTCAATGCGGCCGCTATACCGGCACAAACACCAATTCCTAGAAAGGACGTTCTTCAGAACAACATGACAGGATGTACAATGTACAGTGCACTCGACGTG
GTCGATGGTTATTATCAACTGCTCATGCAAACAAGTGATATCCCCCATACAAGTACTCCAAGCGGTATGCTTTGGGAGTGGCTGGTTATGCCCCAGGGGC
TTTCCATTTTCCCTGGCAACATTTCATTGTCTGGTGACGCAATTGTTCCGCCCTCACCGTCCGTATGCACAAACAAATTTTGATGACATATTTGTCCATA
GTCGGGCGGAACAGGGTCGGTCAGACGTTGGATAACCACATTGACCGTTTACGAGCTGTGCTCGGGTGCATGCGCACTAATAAGTTCTATGCCAACGCGT
CCAAATGTATCTTTGATGCGGACGAGATCACAGTTTTGGGATGATTCATTGGGAAATGAGGCCTCCGGGCATATGCTGCAAAGGTGAAGGCCATAGTGGA
TTGGCCAGTTTCTAAGAATCAAAAGGACTTGCGCAAATGACTTGGACTTGCCAATTACTTGCACAAGTGTAGCGAGTATTACGCTGATATGGCTCGGCCA
TTATCCAATCTCCTTAAAACGGATGTGGATTAGTGGTGCTGTACTAGTAACGAAGCAGAGGCTTTATGACCGTAAAGGAGAGTCTCCTATATGCCCCGAT
TTTGGCCTTAATATATTCTGATCGGCCTTTAAGTGTCGTCTGTGTCGCTCCAGATTTTGCCATTGGCTGTGATCTGTTACAGCCAGATGTTAAGAAACGT
GAGCGTGTCATCGCTTTTCAATCCCGTCAGCTTAAAGCTGCTGAAAAGTACTATCCAGTTCACGACAAGGAGCTACTTGCTATGAAGTATGCTCTAGTCA
AATTTAGAGTTCATCTGCTTGGCTCTAAGCCTTTTGTAGTCTATACCGATCATGCGTCTTTATGCACGGCGACCCAATCGCCCCACCTCTCGCATAGGAC
GGCCGGTTGGCTTTCATTCTTTGCAGAATATAACTTCGAGGTGAAGTATAAGCCGGGAAAGCAAAATACGCTGTCACGACGGCCCGACTATGAGCTTGCT
CATGTTACGATTTTGTCGTCGTCAATTAATGACTTAATCCGTGCACTTTATGTTAAAGATGGATAATGTATAGCTTTGATTCGTAATCTTGCAAGTGATG
AGCTTAAAGACTCGGACGGTAAATTGTCGGCACGTTTGCTATCGCACGGATGCCGCAGATACCCCGCGTATCATTGGTTCTCATGATGAGGAGTTGATGT
ATAGAATCCTCTATATGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGAATTATTGGTGGCCCAAACT
CTATAAATGGGTAACACTTATGTGCACACATGTGAGACGTGCCAACGGATCAAACCCTCGGCACATGAGACTGCGCCGCTGGCTAGTTTGCCTGTACCCT
CTGGGTAATGTGAGTCCATCATTATGCACTTCGTGTTTGGCCTACCGAAGGATTCGGATGGCAGCACAGGCATTGTGGTCTTTGTCGACCTTTCGAGCAA
AATGGATCACTTAGCGGCTAACCGGATTCGATTGATGGTAAAGGTACAGCTTTACTGTTCATTGATCGCGTGTTTCGCCAACACGGACTGCCACTGGCAA
CTGTCTCTGACCGCGATCCTCGTTTTACGGGTATGTTCTGGAAGGCCGTCTTCAAGGTGCTGGGCACCAGATTAGAACATCTCTACCGCGAGTCATCCTC
AGACCGATAGTCAGACTGATCGTGTCAATCGCGTCCTCGGTGACGTCTTACGCAGTGTGTGCGCTGAGACGCCTCGGCGTTGGAGCTTAATGCTCCCCGT
TAATGAGTTTGCTAAGAGCAACGCCGTCCATGCCTCGACAGGCTATACTACGTTCAGCGTGAACGGCTTCACACACCCACGCGTTCCGTTGACGCTACCT
TTAAGTGGCTCAGGACTTGGTAGGGGATGAGGTAGCCGATCGGCTTGCTGATATCAGACCTTCTACTGTTCAAAAAACAGGTTAGCGCGTTCCTCACAAC
GCGATTGAATGTATTACGACATGTGCGTGATTTAATGGCCGATAGCCAAGACAAATAGAAGGAACAAGCGGATGCTAAAGGCAGAATTTTTATTAAAAGT
ATGAGTTCGGTGACCAAGTCTTACTAAACGCTAAAAAACTATCTACAAATGTAGTGTCTGCTGTGCTTAAGACTAATCTGCGTCCTCGCTTCATTGGAAC
ATTTACGGTCGTGGCCAAAAAGGGTCTTGCGTATACGCTCAACTTACCGCGCAAATGCGTACACACCCCGTGTTTTACATTGGCCTCCTTAAGCCGTATC
GGGATCCT