Description :
From Genome Similarity Track
Location :
Scaffold_457:1874- 4060
Sequence
2186 bases(100 bases per row)
TTTCGCGATAAAGTCAACCTTTTGTTGACAATAAGTCAATAAATCGAATCCTACAATTATAACCTGAGAAAATGAGTGAGAACGCCGAACCCGAACACCA
TTTTAATTTTTATGAAGAGCTTGGTGTCCAGCGATCCGCAAGCGAACTTGAAATCAAAACTGCTTACCGTAAACTAGCGCTAAAATATCATCCCGATCGA
AATGCTGGCTCAGAGGACGCTGCAAACAAATTCAAACAAGTCTCCACTGCGTACGCGGTTCTGAGTGACCCAAACAAACGGCGACAGTATGATCTCTCCG
GAGAGACTGGAAAGGGGATTGAGGTTGAAAGTGTGGATGTGGAAGCAATGGGTGGATTCGGTCGAATGGTTGGTGCGCTGTTCACCAAAATCGGGCTTCC
GATCCCGACTCAGATTTCTCAGTCTGTTTTGTCGTCTGCTCGCGATCTGTGTGATGAGAGAAGTAATACAACCAGCACGGTGAACGTGATTGATCTCCCT
TTCGGTGTGGAGAAACACTCCAAAGTCGATAAACAAGATGCCCATTTCTATCGTATAAATTTGGACACAGCCAATGAGTCTCTCGTTCTCAAGTGTCGAT
CCATGTCCAAAAGCAAATTCAAACTCGTTTTATTCGATCAAAGTGGAGGAGTTCGATTAGTGCAAGAGTCGGTTAAGAAGACCCGATACACTGCAGCGGA
TATGTATTTGACCAACTCGGTAGAATTGATGGATTTGAATGAGATGTGGCCACCTCATTTGAGTGGAAATGAACAAGAGCTACCAGAGATATTCAACAAA
CTGTCCTTTTTTGAAGTACGGCGCACGATATCTCTCGAGAAAGGACCCCATCTCATCTGTGTTTATGGCGATAATTGGCTTTCTGCTGTAAAGTACTCTG
TGACATGTGTGAAAATGGAGATATCGTCTCAAGCATTACAAGTCATTCAGGAGACGGAGACTATGCTTGTGAGAGAGAAGGAGAGTTTGGACAGCCTTCA
GAAAGAATACCTTGCAGCCAAGAAACAATATGAAGACGTATTAGCTCGTGTGGAAGAAAAGCAAAAATACACAGTAGAGGTTATGGCGAAAAGAGAGCAA
GCTTATGACGAATTTCTAGCAGAATGTCACGGAAAGGATAACAACATCGTACCGTGCGAAGAGGTACCTCAGCGAAGATTCAGTTCCGGTGGCGACTCGG
TTGGAATTCGAAAAGTAATCAACGGCTTTTCCAACAAATTATTCCAAGGAAAAGACTGATACTTGGATATCGATGCAAAGAGGATTTTTTCTTGTTGCGT
TTACGTTTACGTGTTTCGACTTGCTTTCCAGCTCTCTCCCTCGCTAAAGTTGATCTGATCATAATTGCAAGTCGATATGTCGATTAGGAAGCAAGCAAGC
GTCTTCAAATCCATCTAGAATGTCCACTGCGATTCCAGCCGCCATTAGCTTTTCAACACCGCGACAGTGCACAAAGTTGCTCGGTTCTTTCACACCGATA
ACGATTCGATTTATTTGTGCGCGAATACAGTAGTCTACGCAGGGTGTATTTCCTGAGAGACGTTTACTGCACGGTTCCATTGTGGTGTATAGAGTTGTGT
CGCTTGCGATGAAATTGAGCTTCATTAACGCGACTTGTTCCGCGTGTGTGTTGCCAGGGAGCTCACGGGAGTACCCGGTTGATAATAAGGAATCGTTGGA
GACGATAACACAGCCCACGCAGTAAGCATTCGGACTCGGAATCGATTTATTCGCTTCAGAAATCGCTAGTTTCATAAAGCGCTCATCGAGCTCCATTCAA
GGTGATCAAACAGTAGTCGACATTTTAGTGGCTCGATGCGTCACATTTTATTATATTATATTATATTATCGCAGTCGAAGCGTTTCGTAAGCTGTATTTG
CAATGTCTTTATTGTCTTGTCTTGGTGCGACTTTGATCTGCTGGGTATCCTCCACAAAACCGGTACGAATCGAATGTCCAATGGTACCGCATACAAAAAA
TGACTCAAAAACTCTCTTCTTGTAAACAATGCGATTGACCAGTGATGTGATATTGCAAGCGCAAGTGTGCATCAACCCACTACGGGAACGCGAATTATCG
CTACGAGGTACACTCACTCCATCCCAATCCTCTAACCACAACAGTCGATGCTCTATAGGATACAAAGCACCTGCAATTGAAAATCT