Description :
From Genome Similarity Track
Location :
Scaffold_47:187392- 188826
Transcript NameFunction/comments
g12778.t1hypothetical protein

Sequence
1434 bases(100 bases per row)
CCAACCTCTCCTCAAAGCCACCGACTGGTTCATTACGGAGGAAGACATTGTCGACTCGCGCGGAGGTGTCCCACGTGATGGATTGCAGACGTACACGACC
GGCAACAATGTTACGGTTTACACTGCGGCAAACGAATTCTTCAGTGCAGTGGTAGACGATTTCTCGGCCACGAAGGAGGGCGACCGCGTCATGTATACAG
GCTGGGATACTTGTGTCATTCCATTTGAGGCTGACGTCGACCCTACAGGCGCCAAGACAGGCTTTGACGTAATGTTCAAAGGCATCGTCGAGCGTGGTGG
AAGTGTCAACCTCTTGTCGTGGCCAAATTTTCTTCTCACGTCTCAGAACACCAACGCGCGCGACGCCATCAACGAAATCCCACCGTCCAAAGTTAACGGA
GCCAAGGCTGTCTACCTCTTCGACGACCGACTTCCGCTAGCTGCATCGTCCCACCACCAAAAAACGATTGTCATCGCAGCAAACAAGTCGACTGGTAAAG
ACGACCACCCCATCTCTTACGTTGGCGGCATTGACCTCACCAACGATCGATGGGACACCATTTACCACAATAACACGGCCATCCGTGAAGCCGCCAACAT
CCCGTTTCGCAACAAGGGATGGATGGACGCGCACTTTAGGATCCACGGGCCGGCATCGAAGGAAGTGGCCAACAATTTCCTCCAGCGCTGGAACTCAGAC
TACAAACCGTGTCAGGGACTCGAGGACGACCTGCTCAGCTTCGACAATCCGGACTACGAGAAGCTGCCGCCGATCGACTACGCCAGCAGCAATACATCGT
CAAAGCTCGGCAACCAAAATATCCAAATTGTGCGCACCTTCAGCTGTACCTATAAGCACTATAAGGAATTCGCGCCACGTGGAGAACAGTCCCTCTTCAA
AGCTCGTCTCAAAGCGCTCCGAAATGCCAAGAACTTCATCTATATCGAAGACCAGTACTTCATCTACGTGCCTGAGCTCCTCGATGCACTCATGGAAGTC
CTGCCCAGAATCCAGCGTCTCATCGTACTTGTACAGCCACCTGACGCTCTTCTCAAGGCCTCAGGATACGAAAAGTACCTATACGAGATGATTGGGCCCA
TGAAGGAGAAGTTCCCGAACAAGGTGCAAATCTACACCACTAAGAAGGATCTCGACATCTACGTCCACACTAAACTGGTCCTCATCGACGATGTGTACGT
TTCATTGGGATCCGCAAACTGGAATCGTCGCAGTATGACGTCCGACTCGGAACTCAACGCCAACATTATTGACGACGAGACAGTTGAGTCGCCAGATGGA
GTGACTGTGCTTAAGCTAGCTCGCGACATGCGCGTCCGCAAATTTGTGGAGATGACGCGGCTGAGTTACGAGGAACTCGCCGCAATGAAATTCATCGATG
CAGCGGACCAGTTTAAGGTTGCTGCTCAAGATGA