Description :
From Genome Similarity Track
Location :
contig_35:187356- 188875
Transcript NameFunction/comments
g8333.t1hypothetical protein

Sequence
1519 bases(100 bases per row)
CCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCC
TTCTCTTGATAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCAC
CTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTT
ACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGA
CACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGCGATACCCAGTATCGCCACGACGGCTCCTCG
CCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGC
AGCTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCG
CAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCC
TTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCT
TGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTA
AAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGA
TACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTC
CACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGCGTTGCTCCGTCGGT
GATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTG
CACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTTGGACGGACTACAAAG
TGCTACCAGGTGTAATGGG