Description :
From Genome Similarity Track
Location :
Scaffold_540:18732- 20311
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_540-snap-gene-0.8Crinkler (CRN) family protein
Pytap_DAOMBR444maker-pag1_scaffold_540-snap-gene-0.9Crinkler (CRN) family protein

Sequence
1579 bases(100 bases per row)
tGTGAAAGTGCCGAGCTTCCCGAGAAAGCGAAAACGCTCCGAAGAGTCGATTGTCGATCACTTGGAAGCACTGCAAGTTGCTGAAGTCGAGTTTCAACTG
GATGCTCTCTCGGATAAGCTAGAACATGAGGATCCAATGGTGATGACGCCAGGATTGCATACCTTTTGGAGAGGATGTGGTGATTTTCCGTCGTCGTATT
TCGTTCGGAAGGAAGAAGTGGTGTTGTGGCAAGTGGTGAAGGGAATGCTTCCGACTGTTGGAAAGAGGCGCATCGTGATGGTCGGCTCACCTGGTGTTGG
CAAGTCGTGATTTCTCATGCTTGTGGGCATGTACGTGGCATGTGTCCAGAAGCGAAATGTGCTGATCATTCGACAAGTGGAAGAAATCAATGTTGCGAAT
GTAGTGGTGtATTTTGATGGCAATGGATCGTTTTCACGGGCAGAAAATGTATCGCcTGCTGAGTTGCAcGTTCTTCGCGAGAACGTTCGGGgTGCTCTTG
TACTGGTGGATGGTTATTCGCAAGCTTACGTGGATGCAGAAACGAATGGACTTCTTCCATTTCACgTTCTCGCGACATCGTgTTAGTATGACGCGAAGCA
CGATGACCCGTCACATGTTGTGGTTTTGCCGGCGTGGCAGCGTGACGATCTAGAAAAATACGCACGTTTGACCAATTGGGTAATCTCAACTGGATATCGC
AAGAGCAAGAATGTGAAGGATTCGACGTGGCCGAAGCTTGTCAAAGAGCAGTACTACTACTCTGGTGACAGCCTGCGCGAGTTCTGCAGGACACGTGAAG
CTCTCAAGGAACAAGTTGAAAAAGATTGCGGTGAAGTTGGCAATGCGCAAGCGTACGAACTGATATATACGTATGGAGGTGATCAAAGCAATGATCAAGT
GGATCGAGTTCGGCGCCATTACATCACTGATtCACAGAACGGAGATCACtACACGAAGTGGAGATACTGGAAGCTCTCGATCGATTCTGGATACGCATTA
AAGTTGTTGGGAcGACATGTCAGCATGGAGGAGCagCTGGAACTGTTCAAGTACGCAGCATCTATTGGTaCTGGCTTCttgggTGCCGCATATGAGCTGT
TATTGCACCATGTCATCTATGAAGCATACGCAAAGAGGAaTCCTATTGTGTTGAAGATGAACAAGGGATCGTACTACGAACGAATCGAGATATGTGTTCC
ACATGTTGAATGCTGCGGCGAGAATGAAGATGAGTGCTACGTTTGCTTGACCAATCTCTCTGAGAGGACTTActGGgATCCCGATTATCCATTCTTCCCT
TTCTtCGACGCAGTGGTGATGTGTGAAGCGTTTCGGAGTGGAAGCAATCGCCCcGAGGTGATCGTGGCTTATATTCAGGCGACCATTCGAAATGAtACAA
CCTTCAAGCCGCATCGACTACGCGAGTTGAACGAAGCGATGAATAAGAaCCCGAACATCGCTGATTTtAATCGCGCGTTTGTGGTGgTGGGCCCAGACGC
CACTGTCTGCGAGACATTCACATTGCGTGATGCTCCAGCCCcAGAGGAATTTtGGACGCTGGTTAGCTGCTTCGACCCA