Description :
From Genome Similarity Track
Location :
Scaffold_12:18731- 21853
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_12-abinit-gene-0.97Tetratricopeptide repeat domain 37

Sequence
3122 bases(100 bases per row)
GCTTCGTACCAGTAGCTCAACCCAATATCGTAGTACAGCTCTGCAAGTTCCTCGGGCTGCGACTCGACATTCGGCTGGCGCTTCAGCATGCTGACGGCAG
CTTCATACGCCCTTCGTCCTTCGCCAACAAAGCGAACCCAGCCTTCTTCGTTCTCGGTGTTGAAGTCGTTCGGAGACAGGTAGAACGCAAAACTGTGCAG
GTCTCCAATCAAATTGAGGGCTTCTGGCGACGTTGCGATGGGCGACGACGACGGCAGAGACTCCATCACCTTGGACGCCTTGAGAAGATTAGCAGCCGCC
CGCCCATACAACCCGTCAGCACACAAGGACTTCGCTTGCTGGAATAGAAGATCCGAATATATCATGGACACTGCGCTCTGATCAGCGTCACTCTCGCCAC
CATTTCCAAAGCCTGCGATCACAGGTTCCACTCGCTCGAGCGCTTCGTCATAAAGATGCAGCCCTCCTTCAATTCTCGCCAACTCGCAGCGAACACACCA
GCTGTCCTCGCCGAGCTCGATCGCCTTCAAATATGACTTGTGCGCCGAGACGTGCTTGCCAAAGTGCGAGTAAACATGAGCGAGTGCGACCCAGTAGGTT
GTGTTCAACGGCTCGTTGCGAAGCACCAGATGCAGTTTCTCAACCGCTAGCTCGTCGTCTTGGTCCACAAGGTGTTGCGCCAGTCGAATGAGTGCCCAGG
TCGGAGCATGCTGGGGATCACGAGTCACGTCCTCCCACAACTTGACATTCAGCTCATGCTTTCCCTGCGTAGCGTACAAGTCGCTAAGTTGCTTGCCAGC
AAGCTCGTTGGTGGGGGACAGCGAGAGAGCCTTGAGAAAGCACTTTTCCGCACGCACGATATCTGCCGCAACGTCGAGGTACCATTTCCCAAGCCAAGCA
AACGTTTCTCCATCCGAAGGGACAAGCTTCGCAGCTTGAAGTAAGTGGGAAAAGCAGTATGGCTTGTCTGCTCGGAACGATCCGCCAAGGTGCCAATAAA
CGATAGCCAGACGCTTGAGTACCTTTCCTTTGGTCACAGCGCCAGATACAGGAACTCCGGACACACTAGCTTCGAGTGACTTGTGCGCATTCGTCGCATC
CCCTTGCACGAATAGAATCCAGCCACGGGTGCAGGAAATCAGAGCAGTTGCAGCATCGTCCACTGAAGAGGGAAGTTCATCCACGAGAGTCAGAGCTTCA
TCAGCCTTTCCTTGGTCCAGCAGCAGTTCAGCCGCTGCGAGAGCAGCTTCAACACTAAGAGAATCATCACCGCTCGCAATCACAGAACGGTACAGTTCGA
GCGCTTTGTCAATGGCTCCTGCGTGCGCTTGAGCCGTAGCACTCATGAATTGACTGCGAGCTTCAGAATACCTGTGATTCAACACAACGTATGAGTGACA
AAGACATCATATCGTCGAGGAACATCCCCATTCAAACGTACACTGACGAGGAAGGAGGGCCACAGCCCAACTTGGCTTCTTTCTCAGCGATAGAAGCCTT
GGCAAGTGATAGGCGACTCAGACAGCCCTCCACATCGTGTTGCCGCAGCGCGAGCGACGCCAGTTCCACCTGTCCGCGAATGCAAAGTGCAGCCTCCTGG
AAAGATGATGTCGCCATCGCCGAGATTCCATCTACAAAGCTATCACGAGCCTGGAAAAACAAGCGAACACATGGAACGATGGTAAGCTTAGCAACGATGA
TCTGGCTCAACTCCACTCCAGATCTTGTCCTACCTGGTCGAAACTTTGATCTTCCAGATATTTCACGCCTTGAAAGATGAGCACCATTGGGCTCCTCGCA
TGAACAGAAGCCAAATCTCCTGCGATTTGGTGGGCCGCTTCAACGGAGATCGCTGCAGCCATTAACAACATTGCGTGAGTCATTGTCAAGACAACCCAGC
AATCAATTGCCAATCGTACGGCTACTCTCGTCTTCGGATCGCAACAATAGGTACTCTGCAGGCAGTTTAGCCGTTCGGTTCCACTCGATGATGGACTGAG
CTAGCTCGTCGGCGCGGTGCAGCAGAGGTTTTTTGTCCTTTGCATTCTGCAGAGCGTCAATTTGATGGCGCATGAAGAATGCGATCGTGGTTTCCACTCG
TTCGTGGGCAGCATGTCCAGGTTCCCGCCACGCTGGCGAAGACGATACCACCTCGAAGTATTCATTTGAAAGACTTGACAAGCTGTGATCACCCCCGCAA
TCAGCGAGTTCAAAACCCGGTCGCTGGAATAGGTGATCGTGAACAGTACCAACCACAAATAATGAGTGTTCCATGCAGAATCGATCACCAACCAGATGCA
ACAAAACGAATGGAATCGACACAGTACCTGCAGCAGCTCTACCACGTCCAGCCAAATGTCGAATGGCGATGGCAGGTCTGGATTCGGGGCGTGCGAGAGA
CTCACGTCCTCGCTATCACCAGATCGACCGACAAGCGAGTACCAAGCGTTGAATGCCTGAACGAAGCCAAGCATAACTCAGTAACAACACCCCAAAGTGC
AAAGTCCTATTATGCGAGGCACCGTACCCGTGGTAGCTGTTTCAGCCCAGTTGCAGTGCTCGCAATCTCGGCAATCCGGTTCTGGCAGGGCTTGATCTTG
TCCATCCTAGCATAAAACACAAATCAGCTCACTGAGCGTGGATATCAGCGAAACAGCTGCACAGTACCGGCGCAGAACGGCCACCAGCTTGTCCAGCGCA
TCAAGCTTCTTTTCGGGCTGACCGGATGCTTCAAAGAGATCCGCCAAGCCCTACAACTCCCATTGTCGATTAGCAGTGGATCTGAGCGTGCACATCATAT
CGGGATTGCATACCTTCCACGGTGCCGGCATCCCAGGTTTGAGCTCCGCCGCCCTCTCGAAGGCTGTCTCGCTGTCACTCCACTGGAAAACATCCACCAA
GGCGCACATGAGACGAGTTCCAATCGCCTGTCAATCGAATCGACAAGAGCGAACCTGCTCGAGGTGGAAGCTCGCGAGGCCCACGCAGATGAGCGCCTGG
AAGCTGCCGGCATCCAGCTGCGTCACGCGGCGGCTCGAGTCCAGCGCCTCCTGGTACTTCCCGTCCTTGAGGAAGGCCGCGGCCTCGACCAGCATCTGCC
GCAGCATGCTCGCGGACATCTT