Description :
From Genome Similarity Track
Location :
Scaffold_19:187233- 188813
Transcript NameFunction/comments
Albla_Nc14023980
Albla_Nc14023990

Sequence
1580 bases(100 bases per row)
CAGGCAATTGGATTGCTGTACGATGAACGAGGTCGTCAATAAATCCTGGATCCCGGCTCATGAAAACGAGGCATTTTAATGTTAAGTGTTATTGAACAAG
AAGTAGGTGTCTTTCAAAGCGTTCGGAGCTTTGTCGATATGTCCGATAGACGAAGCTATTCATGACGACCTTCTCATTTGAGTATAATATCAAGGACATT
GCCCAGGAAATGCTAAGAGCTGATTCACGGCTTTGACTGATTTGTAGGCTGGTGACTAATACGCTGCTTTTGCATATTGAGTACATTTGATCTCCTAATT
AACATAATTCACCAAACCATCGGGTGTTTAGCGCCATAGTGAGTGAATTCAAGTGTGCTTGTGCGGCTGGAGTCGTCACTTGCCCGCAAGCATGTTCAAG
GATGGCGAACTGCCGCTCCTGTACAAAGTAATCACTTTTCTATCAGTAGCGATGGGATGTCGTACTATAAAGGCATGCGAGTTCTGATATCTCTGATACA
TAGCCTTCGTCAGTATATCGCGTAACTGGCAACAATGTAAGTCTTCTGGCTGGCGAACTCAATCGAGATTACTTGCATGGTGGCATTAGAGTTGGATGCT
AATAATCCTGACTTGATCGGTCACTACACGCACCTCGGAAGGAAACAGACGACGTTCTATGTATCGAGAACAACGCAATTCTGCCCGCAGAGCTCTCACC
TGCGTTCAGCTTCAGAATCTACTGGCCTTACTAAGGTGGTCAAGCACATCGACGAATAAATTCCTGGAGTTGATCCCCACGTACGCGTGCTAAAAGAGAA
TATAGCTGGCACAACAGGCACCATAATTTCATTACAATGATGCACACGGCTGACCAGGCCTTGTGCCTTGCCATTTGGGGTCGCGCTATGCACAATCGAT
GGCTCACGGGCAACTGGGACACGTGTACAACGTGTCGAGACAACTCAATTCATTCAGATCACCGGATAGCTCGTTTCAAGCAAAATCTTGGAGACTTGCT
GGAGCTATACGGTGCAAGTTGTGCAAAGGTACTACTACACTTTCAGCTCTTGGCAATTTTCAGACTTACTACGATCGATTTCGAAGAACTACAAAGAGCC
CAATCTATAGCTACAGTGTAGATCTTCTACCTCACAGTCCATCTTTGATCGTAATATCGCAATACATCCGTGGTCATATTGACAGGCCGTGTATTTCTCA
GTCTTTCGTGGGAGTGGAACCAGGCATATCACCAGAGTCAGTCCCAACAACTTTCAATCTGTTTGTGCAGCACAATACTCCTCAACCAGCCAAATGTACC
GTATCAAATATCTTGACCTTTCGAATTACGAATTAGACGAATGCAAAAGACACGACCGTATTGGAATGGTACATGTAGAGCATGATCATTCAACGCAATA
AAAATGAACACCGAAATTCCAATGGACCCAATAGTAACCAAAGAAACAGCTTGTCTTTCACGATGCTATCAGGCTCATTGGAACCGAGACTGGAAGTGTT
TGGCGAGTTTCCTTGCCTGTTGGCCAATACAGAATGCCTCAAATTCGGCCAAGAAGGAAACATTTTTCTCGTTCAAACGA