Description :
From Genome Similarity Track
Location :
scaffold_538:18722- 22281
Transcript NameFunction/comments
g9087.t1hypothetical protein

Sequence
3559 bases(100 bases per row)
ACCCTAACGACTGCTAGTGAAGAATTTCCGTGAGCAGTCAAGCCGAGACCCAAGTGCCGTCCACACATACTCAATCCAGATCAAACCCAGCATCTTCCAC
GAGTCACCCAAGAAGAGCGTAATCGTCCAACCCGACGGGTACACACGGTGAGAAGATCTTCAGAGCCCCCCCCCCCCATCCGCACGGCAAGCGGAGTACC
CCCTCCGTCAGTCGGGAGTCCGGACGCCAAGTGTGTGAGTGTACCTCGCGTCGGGAATCCTCGCGAACCACTACGTCACAATGGTGCGCGTGCCTGTATC
TTCTGGTGTCTCCGGATATCACCGTGAGTCCAGCCAGGAAGATGCCAAGATCAAAGTTGAGCCAGGAACCGGATCGTCGACGGAAGGTGAATCGCCGTCG
TGGCATCTGAAGAGTGAAGGATACACCGAACGCTAGAGCACTGGGAGGAACTCTGGCGGGGAACGGGATGTAGGTACAGCAATGGACCTGGAAGAGAGGC
CTCACCCTTCGGGGGTGAAGATCCATCCGTGAAAACGGAAGGATCTTCATCCACAATCACGCCCCCAACATCCCGCGTCTCCTAGAAGAAGAAGTCGACG
ATGAGGGCTCCAGACGTGGAGGGGAGTGGAGAAGTCAGGACCTGGACTGCAAAAGATCTTCTACCGGAAGCAGCTCAACGCTTTCCTTGTGGAAGACCCC
GTGATGATGAAGCCAAAGCTGATCGGAGAACTCCAAGGCCCTGTGACCTCCGCGGACAAAGCATCCGATATCATGGTCGCGATCACCAGCCTGATGAACA
TGCTGGAAGAAGCTGGGATCGTCGCTGGTGCATTCGATGCGGAAGCTGTATTCGGTCTCAGCCTACCACTGTCGAGGAGGAGTGCAAACGCTTGTTCAAG
CTGCTGAAGCCGTTTGTAGACGTAACTTCGACGCTGTCGAGCCTTGGCCCGACGGAAGAGTACCCCACCTCCGCTTCCTCGCACCCAGGATTTCGCGTCC
GCGAAGGCGTCTGTTTCCTCGGACGTCAGGTCGGACGGCGCAATTAAGCCAACAAGAATGGCGCTTGGTCCATCCGACGCCGCCATGCTCCAAGCGAGGA
AGTTCAAGGAAGAGAAGGTGGCCGTCAACACCATGGCGGCACCTAGGGTGACCCCTGACCTTCATTGTCCCGATCTTATGCAGTTGTTCTTCAACACGGT
CATGGAAAACTTCCTGAAGGAGCAGGCCGTGGGGACGATCGTTGACCAACCCAAGACGCCGATATCGGGGACGCAGGATGTTGACATGGAATCGGTGGAA
TCACACCATGGATCCCGAACGAGTACGATCCTGACAACTTGAGCATCGACGTTCCACGCCGTGCTGTTGTCGCCTCAGAGACGACCACGTCGTCTGAGAC
CGCATCAGTGATCCCTCGCGTCCGAATGTCTGCGATCTCCGAGCTGAAGGCGTTCTCTGTGCAGAGATACCGACGAAGACCGTGCTCGAAGCTGGGCAAA
GTAAAGTCCGCGTTCATCTGTGATCAAGCCCCTGACAGCGATAAGTGCATCGTTTTCGGGAACCTGCTCACTGGTCCACCACGAAACCGCTACTAGCCGT
TGGGAAGATCGACCCGTGGCAAGTGGAAGGGTCTCCTGGACGGCTTCAAAGTCGAATACTGCGGCCTGGGCGTGTTCCTCGCGAGACAGTACTACCACGC
GAGAAAGAGATCCGACGAGTCGCCGCTCGAGTATCTCCATCGCCTGACTGTGTTGGGTCTCCGAGCCAAGTTGCCGATCAAGTCTGGACTGCCATCCGCT
CTCTGAGAACACGTGGAACACTTCATCGTTACCTTGGACGATCGCGATATTGCGGACCAGTTAACTTTGCTGCGCCTTGCAGATGGGGGATGCGCTGGTG
GACGTGTTGCGCATACGTCAGCGTGCGAAAGCCCGGCAAGGCAAGGCGGCCGCTGGATCAACCGAGTACCGTTCTGACGGTACTCGAAGGCTCCATAGGC
ACCTCCGCAAGCCTCGGTTAAGCATGTTCGAGCTGTGCGTGCAATTCGCATGACGAACGACAGCGACAGTTCAGGATCAGAATCGGAGTCCGGGGGATCG
GATCTGGATCAGGGTCGATCATAAGTCTATCTCGCCGCCGCCGTAGATCAGCGGAAGCAGGAAGATCAATCGCAGCCACGTCGTGATGCTCAAAGATCAC
TGAGCAGCGTGGATCAGCCGCCCCGCCCTCGAAGCGAGGATCGTGTGGAGAAATGTTCGCACTGCGGGTCCACAAGAAACTCCGACCTTGGGTGCTGGAA
GCGCTTGACTTGTCAGAAGTGTGGCAGAAGGGGACATCCTGGAGATAATTGCTTGTACGTTTGCCGAGCGTGCGGTGAAGTGCATGAAGCCTGTGAATGT
CCGATGGAAGTGTTTTACAACTTGATCCGCCAGTGGTACGATCCCACGCGTCACGCCGGGATTTCCCGAAGGCAGATAAGATGTTAAACTAGGACGCTCG
CCAGGTTGGAATCTGGTACGAGCCGAGCTTTCTAAGTTCTGCATATTTGCATACGTTGGCAGGCAAGCGAAGTCGAAGGTCAGTTCTCAGTAGCATGATT
AGACGACATTGTCTTAATGTCCTATTAATGAGAGACGTACCTTCACGATCGCGAGCCTGCGGAAGGATGAGTATGCGCAATCGGATGTTGTGACGGGGTT
GGACTTGGCTGATGGAAAGACTCGTGGATACTGGAAGGATCATGTTCCGGATACGAAGCCTGGAGAACTCAAGGCCGTGAACTCGTTGACGAGGACCCCG
CCTGAACTCGGCTGGGACCTCAGACGGGGTGAATCGCGATGATACTGGAAGTACTACTCGCCCGGCAAAGTGGTTCAAGCAGGCGAAGATCACCGGGAAG
ATCAACAACTCGAAGTTGACAATGCTCTTGGACTCTGGCGCAGAAGTCTCAATTGTGGACACCACTTTTGCTCGTAAGGTTGGCTGTATCATAGACGAGA
GTCAGAAACAAGAGTGTGTTGGAATCGGAGAGAACGTATACACGACTCTGGGGCGTGCCACGATCAAGGTCACGCTGGCTGGATACTTGGCCTACTTCTT
CGACGCTTGGGTTGGGGTGCCTTGGCTGGTCAGGACACGATCTTGGGCATGGACATCATGATCCCTGCCGGGATCCGGCTAGATCTCGCGGACGGCCCGA
TGTGCTTGGCCGACGAAGTCAGGATTCAGCTGTCAGGTCGACGTCCGCCGTATGGCCGAAGCAGGCATTCACTGTTACTGGAGGATGACGTCGCCGTCCC
CGTCGCAGGATCTGCCGAAGTTCCCCTAAAGCCACTACGCGCGTTAGAACGAGAGAAGTTGTGGATCGTGCGTGGAGAAGGATGGGTACCTACCGTCGTG
AAGGGTGCTGGACCTGAGGATCACCAACGTCGGTGAGCGGGAGCTCCATCTGTCGCGGAGCACTGAAGTGGGAATGGGTGTGCCGGGTCACGAATCGTTG
GGACCGCGTCGATATGTGGAGTGGCAAACTCTCGCGTTCGAGGCGACCACTGATCGGCA