Description :
From Genome Similarity Track
Location :
Scaffold_100:187204- 188762
Sequence
1558 bases(100 bases per row)
CTTCGTCATACAATTCACGGTAACGACCTACATTCCGCTGCCCACGACTCGGCGCTCGCTGAGTCGGGCTTAGCTTCATTAGAGTCAGCATGTGGGAGTC
TTCGAAGTATTGAGTCCCCTTGCGTGCGCGGAACACATCACGTCTCTTCGTCTCCGGGGTCTTCGGCAAAGGAATTTTACTTGGGTCTTCGCCGAATGTT
TTGAACTCGGCTACTCGGCTGTACACCTTCTTCGTTCTACCAGGGGCCTTCTCCAATCCAAACGCCACTCTCAACTTCTTCTTCCATTGCCAGAGCTCAG
CTCCGCCACGGGTCAGACTCCAGTCGGACAGGATGAGGCTGTTTGGTCGGCTGTTGCACCGATAGCCCATCGCCTTCAACAGCAACACAGTTTCTTCCAC
CAACTGATTGATGTTGGCTGCACGCACCGGTTGAGTTAGCTCGGGACCCAACATCGGCCACTTCGCCTGCGCCATCGCCACAGGCGCGAACATCATCATC
CATTCCGATCTCGTTCTCATCTCCTCGCCGAGTCGAGCCAACACTTTATTGGCGCTCGGCGTATCGGCGTTCCTCGTCGCTTTTGGGATAGGGGGCGGAC
GGTCCCCTTGAGCAACGTCATGTCCTTCTTCATCTTCTTCATCGTCCGCACCTTCGTCGAGCTCGGCGGATAAGTTGCGCTCGACAGGACGTGTGGCTCC
CATGCGTCCCACCTGCAGCGTCAACTGTTCCACCTCGCCAAGTAGCTCGGCGGTAGTCTTCGTTTCTCCGAGCTCAGCGGTCTCGGACTTCTCTTCATAC
TCTCCTTCACTTGCATCTCCGTTCTCGCTCTCCTGGTCTTGGACATCCTCGTCGAACTGGACGGCTCGTCCCACCTCCATCGTCATGGCGATGAGTCGTT
GATCCGCCGGGTCCGACCCCGCGAGAGGCGATCCTCCAGCCGTCGCTGGGCTTCCGTCGCTCGGAGTTGCTGATCCCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN