Description :
From Genome Similarity Track
Location :
Scaffold_1448:1872- 2960
Sequence
1088 bases(100 bases per row)
TAACTCTTTGCGAAGCAAACACTGTGACCGCTCATTCTCAACCTGAGCAAAGGCAAACTCTGTCCTGTCCTTCTCCCGATATGAGCTCAAACGGTTCACA
TTGCCAAGCCAATCCAGACACCTCCCCCTCTCGTGTTCGAGGTCCTCACGGAATTCACACTTTACGCGGTCAAGCTGGCTCACAGCATCAGGCTGGATCT
GAAAATCCGTCGGACGTTGTGTTTCCTCCTCCACCTCATCCATTGGTTGATGTGCGTGGTGGCCAACGATTCCTCGTGGAACACCTATTGAACCACCGCG
ATGTGAAAGGACGTCAGACGAGTTACCTCGTCCAAGGTCGCGGCTATTTGACCTCGGTGGATAGTTAGGAGCCTTGCTTGCAACTGATGGTGGACGTGTT
GGGTCTTGTCAAGCAGCATGGCAAGGTACATCCAATGCCGAAGAAGGCCCATCGGGGAACGAACGCCCAGAGCGCTTGTATAGTGATTGCAAATTAGCTA
TTCCCTCGTACATCTCCGACGAGACACGAGCCCTTCACCAGGGATAGTTCATAGGGTAAGCCGCTGTTGGAGCTCGTGATAAAATGTTCACGCAACATTG
GCACGCATCATCCCAGGAGAGGCATAGTAACTTAGCCTCCCTCGATAACCGATGAAGTTTGTAACATGCACGGGTAGAGGTTTGCTTCTCAAGCCTGTTG
CGCGATAAGGTTAGCTTGTAAATCCAGGCATCGCGTCCAATCTCCCCAAAGTTGTGGATGAACGTATTCCATGACTGGATCAGCGAGGCACCATCACGTT
TGTGGTTCCCGCTGTACCATATATATTTGAAGAACACATCAATAAAGAATTCATGCTCAGTGCGAAAGTCACTCGCGCTAGATTCAAGGCCGTGAAGTCT
TGATGAATCGAATAGTCTTAATCGATAAGGATCGCTTAACATGTCGGACAAGCGATCCAACACATGCTGAGAAGGCAGCCACGCCTTTTTCTTGGTATAG
ACGCGCAGGATGTCGCGATCTCTGACTTATGCGTGGTTTCAATAGAAGTACCGACACCACGACTAGTATGATCGTCTTTGATCGTGAC