Description :
From Genome Similarity Track
Location :
Scaffold_1900:1871- 3517
Sequence
1646 bases(100 bases per row)
CTCTCTCTCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGT
TGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTTGGAGAT
CTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTATTTCCCTGACGAGATGC
GGATCCAGCTCAGCGGACGACGACCGTTGTATGGGGCGAAGATGAGGATCATGAGGGCGGATAAGACAACCTGGATCGAGCCCGGGGGAAACCTGGGAAC
TTCCAGATCGGTTAAGGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCGACCGTAATCCAGGGACCAGGTCGATCACGATA
CCTCCAGGTCACGAACGTCAGCGACAAGAGACTGTTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGA
TATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCCCTCGGAGAGGTGGAGCTCCCGGCGG
AGCCAACTGGCCCCTTGGTTGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATC
CACGACGGGGGACGATCCCCAGAGTCGGCTCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAACGGCCGGATCCCGCTGAT
CCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTAGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGTTAG
AGGACGGACTAGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGA
TCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGTTCTGGGAGAAGGCATGGCGGTGATC
CCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATACAGGGGCGAATGAACCTGCTGAAGTGGACCGTCTGCGTCAGAAAA
TCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGAT
CGCTCAGAGGGTGCGGAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCC
CCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGACTCGATTGATGG
TGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAA