Description :
From Genome Similarity Track
Location :
Scaffold_6:1870723- 1873101
Transcript NameFunction/comments
Physo_336840Hypothetical protein

Sequence
2378 bases(100 bases per row)
GATCGAAAGATCGCTCTCTTCTCTTGATGACAGTCTTGATTTAGCAGCAGAGTGCTCGCAGGATGGAGCTGACGCATCGCGCGTGCAGGGTACTATTCGC
ATTGCTTGGATTCTTGCATGGGGCGTTTGTGCAGGCTGTTCACCAGGCCGCGGCCCAGGCCGAGTCGTTCGGATTCGTTGCGCTTAACACGAGTGCCAGT
AGCAAGTGCGCTGCAGGGCCGCTGAACGTGTGGTTTACATTTCGGCGTGCTTCGAGCTGAGCGAAGTTGTGGCGATCCACACGTGGATCAGCTCTTCCGT
TCGCGGCTCTATTCCTCCCTACTACGTCGACGGCGTCCCCGTTTCCGTCAAATACTACGCGCGACTGGGGAACCCCGTGGCTCCAACCGACTGCGACGTC
GGCACAACCAAGCTGGACGCGGCGACATTCCAGAGCGGAATCAAAGGGATGACTTCGGACAACCCTGCAGCGCCCCTTGCCAGTCCAGAAGCGATCATCA
GGTTCGTCAAGGACAATGGGAAGTTGGCTACGGTTGCGTCTGCAAGTGCGTTTTACTCGGTGCAGTTCCATGTATATGACTGGTCCTGCGCAATGCTCGC
GACGGACAAAGTCCTCTCCACTCTGGGCGATCTCAAGGGGCTCGACGCGACTTCTATCGCTCGCTATCTCCCCTGCTATCGGATCTCAGGCGCGGTCGGC
GTCTCGTACGTGGACACGAACAACAAGCAGCAGTGCGCGTGCGTGCGCCCGGTTGGTACGGCGCTTAATGGCGCGTCTTGCACAGCCTTGGCATCATCAA
ACGAAGGAGGGGGCAAGTGCTTGTGGAACACCAGCCGACCGAGCGGCTACACATGCCCCTGGACCAATGCAAGTGCGTCCGCACTCAAGTTGATCAGCGA
CTGCAAAGTCGACGTCCTTGTGCCTAGCGACAACTACGGTCGAGTCAACAAGTACGACAACCTCGCCGTCCCGTTGGACCCCAAGATTGAACTCACGTCT
CGCATCGAGGGCCGTGTCCATCCTCGACACCTGGCAGCAGTTCCTGCTTCAGCCTCAACTTGAAGTGGACGGCATCGAATTCCGCAGCTTCGGAGTGTAC
AATGTGACCATGAGCGCCACCGACAACTATAGCGAGGCCACTTGCGATTGGATGCGTCGCCGTTGTCGACACGTACCCTCTGCATGCGGTGCAGCCCTGT
GCGACTGCAACGTGGGGGTCGAAGGCAACAGATCCGACGGCCTTGACGTTGCTGGATCTGCAGACGGCGGTGAGCAAGGAGGCGAGCTTCTTGTCATTTT
CAAGCGCCAAAAACGTCGTGAACAACGGACCAAGTGAGCGCGTCGATATCGTCACGCGGACGATGAAGGACTGGGTAGAAGCGTCCTATGTCGCGATGAC
TTCAGCCTCGTCCGCGTGCTTCCACGACTACGTGGTTCGTCACTTGCTGGAACAGCTAGTGTTGACTCAGAGCCCATTAATGCTGAGCTCTACCGCTCTC
AGCAGCCTGCAATGCATGCGGTGCTGCTCCAAGCAGACAACGCTGCGTGAATACTACTACGACTACACGTGCGGCGCGTCCAGCGGGCCACCGTCCAAGC
TGATCTCTGGGAACGAGACGTGCGCGTTCAACCACTGCCTGCGTCTTACGGGGTCAGCGCCGGTGCAGGTGTCGGCCTCGCCCACTGCTAATGTGATGAC
CCCAACCGACCCGATGACTATCAGCCGCAGCTCGCCGTGCCCCGTACTAAGCAGCACTTGCTCGAATGCAGCTACACTATCGAGTCTTGTGAACACAAGC
GAAGCCTGGAGTTCTGCATTACCGAACCAGAACGCCTACGTTGCTGGGTATAACGTCTCCGCGTACGTGTTCTGGTGCTACAAGAAGGGGACCGACGACT
GGGTGTTATGGGACGACTCGGCTGTGCTCGAGTTTACTTCTGCTTCGACGGCGCTGGTTGTCCAGGCTTGGACGCGCTGCAGGATGGTTCGACAGTTTGA
CTTCAAGGTTGCGGTGTCTCTGTTGCTCACTGCCATCCCATCCAGTACGGCCAGCCGAACTCCAGCAACAATCAGCCTCAACGGTACGCTACTAGATCTC
TCCAAGATGCCTGCGAGTTGCCTGAGCAACGAGATGATGACGGGATTCAAGTTTTCCAGTTCAAACGGCGCGAACGCAGCTTACACGTCGCAGTGCGCGG
CCGTCACGGGTCTAACCAGTGGTGGACTCACCACCAAGACCACAAGCTGGAGCGCTCTGTTGACGAGCGAGTTCTACTATTAATATATCTACAAGCTCAC
CGCCCACCTGATGGACTGCGGGACGGCGGCCATCAACTCCTTCAAGCTCGAGACCAAGTACGAGAGTGCCTCACACTT