Description :
From Genome Similarity Track
Location :
Scaffold_41:187035- 215583
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14740callose synthase
Phypa_INRA-310PPTG_14741hypothetical protein
Phypa_INRA-310PPTG_14742hypothetical protein
Phypa_INRA-310PPTG_14743endoplasmic oxidoreductin
Phypa_INRA-310PPTG_14744hypothetical protein
Phypa_INRA-310PPTG_14745aldehyde dehydrogenase
Phypa_INRA-310PPTG_14746carbohydrate esterase
Phypa_INRA-310PPTG_14747cysteine protease family C26
Phypa_INRA-310PPTG_14748hypothetical protein
Phypa_INRA-310PPTG_14749seryl-tRNA synthetase
Phypa_INRA-310PPTG_14750COP9 signalosome complex subunit
Phypa_INRA-310PPTG_14751hypothetical protein
Phypa_INRA-310PPTG_14752hypothetical protein

Sequence
28548 bases(100 bases per row)
TCGGAGACTTTTGGCACTTTACCTCAGGATTTCAAGGAACTGATCGAGATTGTGCCCTTCACGGACTGTGTGGAGAAGACTGTGGGCCGCTGCAAATGCT
ACCACGACTTGATCGATGACTGCTTTAGTGACTCTGGTGAGGCTGATGAAGTGTCCACTGAAGGTTCTGTGGCGTCCATTTCGTACGACCAGAGCATGTG
TGCTCCTTCGTGGTTGGAACAGGTTAATAGCATTCTGGATGACGAAGGCGATGGACTTCTCAACTGTGGCAAATGCCAGATTGACATCACTAGTCTCGCG
AAGAAACCGACTCGCATTATGGATATGGTGCAGGGTATGATCGACTTTGGTCGTGATGATAAGGGACCAATGGCTCTCCTTGGTGGAGCAGCGATGATCG
GACTGGTATGCGTGTGCGAGCTGCAGAACCGTTTCTTCTCTGGTATTGGTATGGGCTTTGTGGGTCGTTCGATGCCTGTTCCGATGAAGACGTACTGCCG
CTACACGTGCTTCTGGATCGTGCTGTACCTTGTTAAGCTTACTTTCGATTACCAGTTTGTCGTCAAGACACTGGTAGAAACGACACTGTTTGTTTACTCG
GCCAAATCGACGGATTACCTCAAGTACTCGCACTTCATGCTCCAGATCACGTACCACAACATCGTGTACATTCTGTTCCTGTGGGTTCCAGCGTGGATGG
TGTTCTTGTACGACGCGCAGATCTTCTACTCGGTGTTGTCCGTCATCTACGGTTCCTTTGCTGGTTTCAACCTTCGTATCGGTGAGCTCCGCTCGTTCCG
TATTCTTCGTCTGACGTTCAAGTCCATCCCTGGTGTGTTTAACCGCAAACTGGTGCCGAATATTGTCGAGGAGAAAGCGAAAAAGAAAAAGAAGAAAAAC
AAAAAGAACAAGAACGACAAGGACGAGATGGCCATGCCGTTGCGTCGTTTCGAGCGTATTTCGATGTCTCAGGGCGCCAAGCCGTTGACGGTGAAGACGC
AGAAGTACTCGAGTCTGCTGGAGCAGCGTGATGATGATGATGTGTACAGCGAGATGAAGACGCCGAACGGCACCGACGAAGACATGTCGTCGCAGTCGAG
CCGCTCCTCGAACATTGGCTCCATCACGGGTGTGTCGGGAGCGGAGTTTGAGCGCACGATTCCGTTTGCCATGGCTTGGAACCGCTGCTTGACCAGTCTG
CGTGAGGCCGATGTCATCAGTGACCGCGAGCTGAACGTTCTGAGCTACTTGATCGACTCCAAGGACACTGTGGGCCGTAAGCTGTACCCGCCGGCCTTCC
TGACGGCTGGTAAGCTTGACGAGTCGATCGATATTGTTCTTGAGTGCTCTGCGTTGTATGAGAAGCTGAAAACGGACAAGAAAAAGAAGGACAAGGTGCT
TCAGAAGATCGAAACGACTATGCGCGAGCGTCTGACGAAGGATGATCTGCGTGTAGAGTCGATTCTGGGTTCATACAAGTTCTCTTCTCAGGTCCTGCGT
ATCCTGCTCGGCGAGGAACACAAGGAGCTGGACGACTGCTACAACTTCATCGAGGAGATGGCGTCGCACCAGCAGATCCTCAAGGGCTTGAAACTGGACA
ACTTGTACCTGTGCCGTGCTGCGGCTGCGGAACTCATGAAGTCCATTCTAGAGGTGCCCAAGAAGTCGACTGAGACTAGCATCAAGTTCCAGCGTGCACT
GTACAAGGTCATTGACTCGGTGGAGTCCGTGATTAACTGCCTTAAGATGGTGCTGGCGAAACAGGAGAACTTGGTCCAGATGCTGAATGACACACCGCTG
AAGCCAAACTCGTTCTTCTTCCCTGGCGACTCGCAGCACTACGCCAGTCTCCAGCTGCAGAAAATTGTGAACGACGAGGCCGCTCTTGACATTGTGTCGC
GTGCGTACCAGCTCCTGACTGTGGATAACTTCGATGCCGAACCCCGCTCGGAAGAGGGACGTCGTCGCCTGCGTTTCTTTGCTAACTCGCTCTTCATGGA
CATGCCTGAGGCGAAGCCTATTCGTAAGATTCGTTCGCTGACTGTGTCGACACCGTACTACAACGAAATTGTCATGTACTCGATCAAGGATCTGACGGCG
CAGAATGATGACTGCATCAAGCTGCTGTACTACCTGCAGACCATCTATCCGTTCGAGTGGGAGAATCTCCTGGAGCGTATCCAGGCCAAGGACATGAACG
AAGCGCTGAAGAAGAACCCAGAGGAGGTACAATTGTGGGCTAGTTACCGCGGCCAGACGCTTGCTCGTACTGTGCGTGGTATGATGTACAACGCGGAAGC
TATTCGCTTCTTGCACTGGCTGGAGATTGGTGAAAATGAGCCGATGCACCAAGTGACGTGCTCGTGTAACAAGTGCTGTAAGCTGAACGAGATGGTTGCT
CTCAAGTTTAACTACGTGTGCACGTGCCAGATCTACGGTAAGCAGAAGGACGAGCAGAAGCAGCAAGCTCAGGACATCGACTTCCTGTTGCGCAAGCATC
CGAACCTTCGTGTTGCCTATGTGGATGGGCCGAAGAAGGTGAAGGATGGCCCGCCGAAGTTCTTCTCGGTATTGATCCGCTCCCAAGACGAAAAAATTGT
CGAAATTTACCGTGTCGAGCTGCCGGGCAACCCGATTGTGGGTGAAGGTAAGCCCGAGAACCAAAACCACGCCATCATCTTCTCGCGCGGTGAATTGCTG
CAGTGTATCGATATGAACCAGGATGGTTACCTCGAAGAGGCCCTGAAGATGCCGAACCTTCTGTCGACCATGGACCGCGGCACAGAGAAGCGCCCGCTGA
CGATTATTGGTTTCCGTGAGCACGTGTTCACGGGTGGTGTGTCGAATCTTGCTAGTTTCATGTCGATCCAGGAACTGTCGTTCGTATCGCTGGGTCAGCG
TATGCTCGCTCTCTTCCACGTGCGTCAGCACTACGGTCACCCCGATATCTTTGACAAGCTATTTGCTATGAGTTGCGGTGGTACTGCCAAGGCTTCCAAG
GGTGTGAATCTTTCGGAAGATATTTTTGCTGGTTTCAACAGTACGCTTCGTGGTGGCCGCGTCTCCCACGAGGAGTTCATTCAAGTGGGCAAGGGTCGTG
ATGTCGGTATGCAACAGTTGGCTCTGTTCGAGGCTAAGCTGTCTTCTGGTGCTGGTGAAGCTGTGATCTCTCGTGATGCAATGCGCATGGCTTCTCGTCT
CGACTTCTTCCGTCTGCATTCGTGGTTCTACGGCAACTTGGGTTGGTACTTCACACAGTCAATGACTGTTGTTGGTGTGTACTTTTTCATCTACGGCAAG
GTGTACATGGCTTTGAGTGGCATGGACAGCTACTTCCTCGAGAAGGGTGGTCTTGGTATCGCTGGCACATTGAACACATCGTGGGCATTCCAGTTCGGTT
TCCTTTTGGTTGTCCCTGTTATCGCCGTGGTGGGTGTGGAGCAGGGTTTCCGCCATGGTTTTACCTACCTACTCTGGAACGTCATGACTCTTGGTCCAAT
TTTCTTCACGTTCCAGATGGGCACGCGTATGCACTACTTCGACCGCACATTGATCCACGGTGGTGCCAAGTATCGCGCTACGGGTCGTGGCTTCACGATC
AAGCACGAGAAGTTCGCCGAGCTTTATCGTTTCTACGCGTTCAGTCACTTCTACCGTGGTGTTGAGTTGCTCTTCCTGTTGCTGATGTTCTACGCCTACG
GCACGTTCTCGTGGTGCAACTGCTCATGGCGATTGGATGCGGACTTCTACAACAACGTTGAGCCCACTGACCTCGAGTGGCGAACGCGTTGTTACGATGA
CCACTACCAGTCGTGTGTGCTGCCAACGAACCAGAACTACGGTATTATGTCGTACTCGCTGTGGATCATTGCAGCGACGTGGATGTGGGCTCCGTTCTTC
TTCAACCCGAGCGGTCTGGACTGGGACAAGATCATCGAGGACTACAACGACTGGCAGAACTGGCTGAAGACGACGAACGACTCGGCCGACAGTTGGTTTG
GCTGGTGGTCCAATGAGCAGGAATACCTTGAGCACACAACTCGCGGTGCCCGCTTCATTACTGGTGTCCGCAAGCTCCGATTCCTGCTGGTTGCTATCGG
CATGTACCTGAACATGATGTACAACGCGTACTTCGAGCGACCGAACAGGATCATCACGTCGGACGACGACATGCTGACCTACGCTTTGTCCGGTCTGGTT
ATCGTGATCTTCCTGCTGCTGATCTGCTGTGGTTACATTGCCAGTCGTGTGACCAAGAAGATGTCGATGAAGCAGCGCAAGCTGCGCAAGATCAAATTCT
TGCTTTCGTGCTGCTGCTTCCTCATCTCGATGTTGAGTCTCACGGTGCTGTCGGTCGGCAATCTGTTCGCCATCTTCATTCTGCTGTTCGTGGCGGTGTA
CTGGTTCATGCAGATGTGCATCTTGCGGCTGCAGTACCACCACATTGTGGTTCGTGCTCTTGCTCGTGCCTATGACCGCGCCGTTGGTTGGATTGTGTTC
GGGCCGATTATGATTGTGTCGATGTTCCTGCCCTTCATCTCGTCCTTCCAGCAGCGTGTCATGTTCAACAATGCCTTCACCTCTGGTCTCGAGGTATCGA
AGCTTTTCGCACACGACGTGGCTCCGGCGCAGGTCGTCAAGGTCAAGCGCGTTTCGAAGAAGAAGAAAAACCGCGATGATTAAGCTGAACCATTTGCTAG
GTGCTCGGCTAGTCTAGCTATTTTGTATCTTCATAGAACATAACCACACTGTTCTCTGTTTTTTTTCAAACGTTCTTTCTTCAAGCCTTCGGCTGATATT
GATGAGCTTCTGCAAAAGATAGATAAGAAGGAGATATTGTAGCTTGGTACTGGTTACTAGCCCTGCAGTCGCGTGAGGTCTGGAGTTGAGACTACGTGAC
GCATCCCCACGAGCTCGGTAGCTGTACGAGTGCTCATTGCACCATGAGGACTCACAGTATTCCGTTGAGCGAAAGGAGCAAAGCTGCCTGATGCACTCAT
TGCAGGTGCACGGGCTTTGTTTACACGAGGTGGTGAGCCGATCTTGAGTTTCCCGAGGATCTCGGAGAATTTCTGTGTATCTGGCTGGAAGCGCTTCAAG
TCCAGGTTCCTCCGATCGCCCGAAGACTTTACTTTTCGAGAACTTGACGTTGATCCATTTTCACTGCACTTCAGCTCAAATGAAGATCGCGATCGCACCG
AGGGCATCGTCAGTTCATGCGATGGAGACGACGTGCCACTGCTTTGGTCATCTTCGTCTCTAAACTCGGCCGATTCACTTTCAATCGATGACATTGTGTT
GCTTCGACGACGTCCGCTTTCTTCTTCGTCCGACACACGCAAGCTTCGAGTACTTGAGTCACTCTTTGGCGCACTTCCCACATGGCTGGTCACGCCTACT
GGGCCGCCGCCACCTGAACCAGCCGTGATTTCTCTCATACGCATCACGTCAAACTCCTCGGCGTCGACTTCGTTATCAATCTCAATAGCCATCGCACTCT
CGGTGTTTCCTCTTGCCATCTGCGTGGCCAGACTCTGGATAGCATCTTCGATCGCATGCATCCACTGCTCCTGACGGCCCCAAGTATCAGTGAGCACAAT
AAAGTTCTTGTAGCCCTTCGATGAGAACTGTAGGCCGTGCGCACCGCTACCTGGACCCTCAGTCACACCGAAACTGTACCATTTGCGGACCGACGTAGGA
ATGACCCACTTCATACGATTCATCCAGTTTGCACTTTGAAGCGTGTCACAGTACCAGAGCTTATCGCACACTTGACAAAGTCCGAAGAATGTGATGGTGA
ACGTGAGCGCGTGGAATGGCATGGGCACTGGGAACTGAATGAAAGAGCTCACTCGAGTGGGCTCTGGAATAGGAATATGGTCGTGGATCTTGTCCTTTTT
GTACATGAAGCCCGTGATGAACTCGTCCGTGTACGTGACCTTGCAGTAATGACTCGCAGCGCCGGAGAAAATAGTCTCCAAGTAGCCTGTGTATTCGTCT
ACCTCAGCATTCGTGAGCGTTGCCGCCACATATTCGACTGCGCTTTGTTTCAGCTTCAAACACCCGTGACACAGCGGCGCATTACGCTGACCAAGAGGCA
ACATCTCAACACGGTTCTGCTCCGCCAGGACTTGCTCAAATTTCACCCATTTTTCGTGCTGCGACGTATACTGCCGCACGACATCTTGACAGGTAATTGC
AATCGACCCACTCCTGCAATTCGGGGTGCTACATAACACGAAAAACGATTTGTTAGTGTAAGAACTAGTTCGTCGCACAAACAGATGCTGACACGTACTT
GGTAAGAGTGAAAATACTGTTTGCAATCGTCGTCATGTGGCCCTTGTACTGGACATGCTCATCGTATGCGCGGATGACAAAGTCCAGAATATTCGCCCCT
TCAATGAAGAGACTATTCAGCAGCGGGGACGACGGCAATCGCTTCTGATCTGGGTCCATCAAAACAAATCGGATGACGTCCGTAAGTTCGTGATGGAGCA
TACTATTGCTAGGATGCGAGCCATAGCACGCTAGCAAACAGGGCATCAAGCCAAAGTTCGCCAATAGGTAATCCACATCGCCACTTTGCAAGAACACACA
CCGCTTCAAAAATGTGATGATGTGCAGAAGAGCGGACCCTTTAGTGTTCACGGCCTTGATACTCCCAGGATTGTATGAAGTGGACATCACACGAAGCGCG
TTGACATCCGACGTAACCACCGCCCGACACAGCTTCACAAATTTCTCCACTCGCGGAATCAAAGCCGTTAAAACAGATACATGTACCGTCTTCAATAGTC
CGTCGATGCTGGTAACATCACGTTTCTTTTTGTGGTATCCCAGCGTGCTCATCAACATCATGACGATAGAAAGAGCACCGCCTTCACGAACGACAAGGGA
CTTGGATCCTTGAGAGCAATGACGACAGACCTCCGCGAATCCCAAATCGAGCAACGTTCCGAACGAGACATCTGTGGTGTTCAGTAGAAAGATCAACAGC
GACTTGAACAGCTCGTTGTGGTGCAGCGGGAAGTGCTGGTCTGTGATCAAAGGCAATGAGTGGTCTGTGTTCTCCACGAATGTAGCCACGTTGTTCATGA
TGTACACCGAAGGCGGATAGATGATGTAGTTGATCAGTGAGCAAATGTTCTCGATGGAGTCTCGCTGAAACGATGTCCCAACACCCCAGCCAAGAGTTCG
CTGCCATGAGTACAGGCGAGCAAACAAACAGTCGAATATGCCACTCTTCTGCACGTTGAGTTGGCCAGCTTCCGACATGTCCGAGTACAACAGCCACACC
ACAGTGTCGCGAATTGAATCAAGCCCAATATGAACGACTAGCCAAGGCACGATAAACTGCCCTTCATCAGCCAGGAATCGCCACATAAGCTCTCCAAGAT
TTTGGTTCACAATCAAGTGATTGACAACCTTGCAGAAGAGCACCAACAGCACGTCATCCAACGGATCCGCAGTACACACGAAGTTGAATAGCACTTTCAG
GTACCCGGACGAAATCTTGACATCATACGCATCGCCAGTATTTAATGTCCACCCAGCGCCACCTGGCTTGTAGCCCTTCTGGAAAATCTTTGGCGAGTAC
CACAGTGCGACCTCACTGCAGAAATGCTGGACCGTGTATTTGCCGTAGTTGGGATCATCCGCAGGGTCCGAGTCGGGAGAGGTGACAGGAACCGTGAGCA
AGCGAAACACTTCATAAATAATCCGAGGCTGCTCCAGCCAAATGCTCGACTTGTGCTCACGTATCATCTCTCGGTACAAGACGTCAACCGACATTTGACT
GCTTTTTGCAATCTTCAACAAATCCCGTAGCGTTGAGTTTGACTTGGCAACTGTTTCCTCAATTTTGCGACGATGATTCTTGACGGATTCCTAATGAACA
AAGCAATGGTAAGAATAAGCTGTATCAATGCGAAGCACACTGCCACGTACACTCTCCGCTTGCTCACGTAAATAATCTTCAATATCGGTATATCCAGCTA
TACGTGCCAGATGTTCAGCGGTGTGACCATCGCGCTACACATTTTCAAAGTATCGTTAATTATTGTTGCTTGTAAAATAGTCAATATCGGCGCAGTAAGC
ACGAGTATCCACCCACTTACATCCTTTGCAATCAGACTAGCTCCAGCCTCGACAAGAACCTTTACACAGCCAAGATTTCCCGCACGTGCAGCTTCCATTA
ATGCAGTTGTTGAGTTCGGCTACATAATAACAAAATAGAAGCGAGACATCGCTCGTTAGAAGCTGCGAGATACTGAGAAACAAAAAAATGTTAAACTTAC
ACTTTGTGTTTCAAGCTCCGCACCCCCATGCAATAAAATCGAGCAGCACTCTTCCAGCCCACCACGAGCAGCAATATGAAGTGCTGTAGTACCCCGGCTC
TACAAAGTGTCATTAGTTTTCACAATAAAATCACTCGTCAGTAAGCAACCATTCGCTTGCAACATTGCTCCCGTTCACGTACTCGATTTCTGGACAAGTT
TATTCTTGCCCCCTTCTTGACCAGCAGTCTCACACAGTTCGCACGGCCATCACGCGCAGCGACCATCAGCGCCGTCATACCGTGCACCTAACAAGAGCTA
ACCGTCAATTCTGACTCAATTGCAATCGTACAAGGAAAAAAACGTACATCTTCCAAGTCGAGACTAGCGCCAAACATCAACAACGCTCTCGCTGCTTCCA
CATTACCGACAGAACAGGCCATCATAAGCGACGATACACCTGTCGGCTGTCATTTGTGCATAACGAAGCCACAGCATCAGCGCAATTACTCTACAAAGCG
CACACAAACAAGAAACCACCTTTTGTTCGTCCATGGAGACGCCCAGACTGTGCAAAATCTCGATGCAGTCCACATGTCCGTTCTCCGCAGCGTCACACAG
CGCCACCGCCTTGGGAATATTCTGCAATCAAGAAGTATTATAATAAATACACCTTGTGTGCAGCTATTACCAACACTTTTGCCACTTACATCCACCACAT
TTCCAGTCGTGTCGATCTCCAGCAAATGTCTTAGAAGCTCCACATCGCCAGCTCGAGCTGCAGTCTGCACTCCAAAGTACACGTCGTCCGGCACCACGTG
CTTGCATGCCTGTTCTCTCCAGAGCAGCTCAATTGAAATTCGCTGTGGCTTATCTGATAGTAGTCGGTCTGCATGATATTTGGACAGCAATACGATTGGG
ATGGACACGCGCTGGCGTCCAGACGAGTGGAAGCCGTCAAATAGCGACTGGATCGCGTGTTTATTGTCCGTCCGCTCGATGAAGACGATACCTGTGACTC
CAACAGCCAGTAGACGCCTTACAATGTCCGGGAAATGGACGCGGCCGCCGCGTTCGACTATTGCGATGTTTCCCAGCAGTTCCGCTTTGTTCCTGAGCTC
TCCGTCGGCCTTGGGCGGGTTTGTAAACACGACGTTGCCCGTTAATACGCGCGGCACACGATCGTAGCGGTAGCTGGAGGGCTCTGCGAAATGATAGCTA
CTGGTCGTCAAGGATACGCTGTGCAGGTGCGCGTCGATGTCCCCGGCAGGCTGCGACTTGGGGCTGCGTTGCCAACTCACGAAAGGCACGCCGTCGCCGC
GCGCGCCATTCGCAGTAGACTGCTCGTTGCCCATTCGACGGGCGGCCCTAGCTGAGTGAAAGCGGAATTCGGGAGCCCAAATGCAAGAGTGATGGTCCTC
GTATCTTCTTGTTGAAGGAAACGAGGGGCGCGCTGGCAAGTGTCACTACGCTGGATGCGAGGACGAGGCGGGCAGTGACGCGTTGGGGCGTTGGACGTGC
GTGGAGGAGGGTTTCCTTTGGCAAGCTTGGCCGTTGCGAGTTCCTTTTTTTTAGGCTTGAGCTTGAAGATTCTCCTTCGCTCAATAAAAGTTTTGGCCAG
GCAGTTGAAGTGACTGAGATTTTGTATGATGGGATTAGGAAAAAAGGATGACCAGCCGTTTGCAACACGGGAAAATCTGAGTTTTGATTTGGCAGCCAAC
ATTAACAGGGACAATTTGTCCCGGACAAACACCGGCATGGCAAACTGCCATCGGCAATGCAGGACAGCCGACCACAATGCATATTCGTAAAATCTCGCTC
GCTTCGTTTTGCGCTGTTTATCATCTTCAGTGATGTCCGAAAAAAAGTCGACTCATGCGAGGGGATGAAATGTTGAATTATTAACACCGATTGCGCTCGG
GCGAGTTCAACGTTAATTTATTGTCCATGTTCTTGTTGTAAGCGACTGGAAGGCGGTTGATATGTTTTCTTGTAAGTAGTATCTGCTGTGGTTGGGGTGT
CCAGAGTTGTGGCTTAACTTAAAGGGTTAAATCGCGCTGGAGTCGCTGCCACATGCCTAATTGAAACACTCAGAGCCCAAGAGAATGCTACGTTTCGATG
CGTTCCAGCACGTTACAAGTGAATGCGACCACCGTATAATAGAGGTTGTCAATTGCTTTCATACGCACAACTGTTTGGCGAAAAATGTTAGCCACAGTAG
CAGCAAAAAGCTGTTTTGCTCGCTTTGGGCCAGTCTTGTACCATGAATCACGACCTAGAAGTCGTTAAAATGGATACAACAGCTCAAATATTTATTTTTT
TTTTCGATTTCATCATCTCACAAAAAGATTTTCTGAGAAGAAGAGAAAAATGGCTAGCGCGATGCAGGTGCAGCAGCAGCTCACGCGGACTTGGTCCACG
CTGCGTTACCGCATGGAATATGGTGGCTACCTGTCCAACCACCTGCTGCACGGTGTTGTGGCACTCTTCGACCTCGGTGCGAGCGAAGAAAAGATTGAGG
AGTTCGCCGAATGCTACTCGACCAAGTTGGAGAAAGCGGAGCCCAGCCACGATGACGTAATGCAGCCCGACGTCCGCGCGAAGTTCCTGAAGGAGTCGAA
GCTAGCGTTCGAAAGCGCGAAAGGCCTACTCGGCAAGCGCCAGAATTTTGATGGCCTGCTAGCTCTGTATGCCGCTGAAGTGCAGGAGTTGGGGATCGAC
AAAGCAGTGAAGAAACACTTGCCCGTTCTTGTCGGCGGACTAGCTGGCGCGTTACTCCACGCTATCATCCAGCTCGGTTACGCCTACCACATTGGCGGCG
AACGTCTTGTGGCTGAAGGACTGACGTACATGCATTACGCTTACCTTTCGTTCGACGAGCCACAACAAGTTAACGCCGAGGAATTGCAAGAGAAGAAAAC
ATTTTCACGTGATGAAGCGATGCAACTGGTGCGAATGTTAAATGGCAATGATTTTCTGCTGAATGAGATGAGTTGCAAGCTGCAGGCGAAGCCGCTGGTT
GATCTCGAGATTGGCGGTATTCAGAAGCGGTTGAGCACCATGTCGGGTGACCCAGAACGAGGCAGCAGTGAGGCATTCAACTTGATCTGGGACGCTATCA
ATGCATACAATCTGTCAAAAATGAATGGCGTGTTCGCACTGGACGTGGCATTCTGGCTTTATATGATGATCGAGCACAACGATTTCGTCATCCTACACGC
AGTGACGTCGGCGTGGGCTCTACAACAGGTTGAACATCTGCTTGAACCGAAGGATCATGAGCGCGCGTGGAAGGTGTGGCTGCATGTATCGTTATCGGCC
TTCGTTACCAACAAGATCAAAGATGTCTTGACATCCGACGTGTGCGACCAGCAACTCGAGGATCTGCCGGCGTTGGACCCATGGAGGCAAATTGTCGCTA
AGACTTTGGGCTTAGCAGACGAAGGGCTGCTGGAACGCGACCTGGCGCACGCATACAAACTTGTTCAAGTGGCCCACAGCCACGCACAAACCAACGAGAT
GTCGTTCCTATCCGGTGAGGAGCGCGACTTCATTGCTCGCAAAAGTGCGCTCAAGGTGATATCCTGCGAATTTGGTCCACTGTTACTGAACTGACCAAGC
CAAAGCGTGATCTTCAGGCCCCTGTATTATTTACTCGCATGCAAGTTGTGCATCTAGGTACAACCTGAAACTTTCAGGTGCATCAATTGCTTCTCGAAAA
ATCTAGCGTTACAGAACCAAGTTGAAGTGCGATGTTGCATGAACACACGTAACATTCACGCGACATTCCATTTTCGCTGATACAAAACGTCAGTCAGATT
CAAAGCAGCTGCAGCTGGGCAATAAGCTACGTGGCTAGACATCAAGCAACAATGGTCGCTACAGCGTCTTTAAGGCGGATGGGACTGCTCGCCACAGCCG
CCGTCGTAGCGGCAACACAGTCCTCCTCCGCAGCTTCCGCCAATAGCACACCGAATCCGTTATTCCCGAAGGACATGGTGGATTATCTACAATGCCAAGT
ATGCCAGACGCCGGAACTCACGGGCAGTGTACAGGACTCAGCTTGCGACTACGAGACAGTGGATAAGGCCGTGAACGAACACTTCCATCCGCTACTGCAC
GAGCTGTCGCGTCTCACGTTTTTCCGCTACTTCAAAGTGGATCTGGGCAAGGAATGTCCCTTCCAGGCGTGGCGGGACGACGGCATGTGCGCTAGTATCG
ACTGCGCGGTCTGCGAGTGCCCGTCACACGAGATCCCACCACCATGGAGTCTGTTGGACCAACAAGAGCGACTCAGTGAAAGCCAGGAGCAAGTTGGAAA
ACCCTGCGATGAACAGACTGGAGAAAGCACGCTGTCCAAGGTCGATCGCAAGAATGCAGCGGCAGGAGAGACTTTTAAAGAGTGGGAAGAGGTCTCCAGT
GCCAATGTCTGGGCGACTCAAGGCGAAGCGGAGGAGATGATGACTTACATTAATTTACTGGAGAACCCAGAGAGATATACAGGGTACAGCGGCATCCAGG
CCGAGCGCATCTGGCAGGCCATCTATAAGGAGAACTGCTTCACGCCTTCGGAAGAGAGTGTTCTGGACAACCTGTGCCTTGAAGAGCGTGTGTACTACCG
CCTCATCAGTGGGCTACAGGCGTCTATCAACACACACATCGCGCTGACGTACAAATTCGGCGACAAATGGGGCGTTAACCCGTCGCTATTCGTCAGCCGC
GTTGGCAAGCACCGTGAACGGCTGCAGAATCTCTATTTTGCCTACCTGTTCGTCATGCGTGCGATCAGCAAGTACCGACATGAACTGCTGGCTTACGATT
ATAACACGGGAAACGCTGCTGATGACCTTCGTGTGAGGGAAATTCTGCGCCAGCTCTTGCTAGAAGGATCGGATGATGCTCGAGCGTCGGGAGTGTCCTG
TCCGGCGTATGCTGAGTGCTCGTCTGTGCTGTCTGGCTTCGACGAGAGCGCTCTATTTCGTGTTCAAGCTGACGGACTTACTCTCGATCAGCTAGCACAA
GCTCAGCAAGAGAAGGAGCAGCTAGAAGTGCAATTCCGTGAGAAGTTCCAGAATGTTAGTCGCATCATGGACTGCGTCACGTGCGAGAAGTGTCGACTCT
GGGGCAAGCTGCAAACTATGGGATTGGGAACAGCCATCAAGATCCTGCTCACAGAGGACGTGTCGACAATTCCGAAGCTACATCGCAATGAGCTCATCGC
GCTCATTAACGTAGCTAACAATCTCTCTCGCAGTGTGGACGGCGTCAAAATGATGCGGGAGCTCGAGTTCATCGAGGCTGTAAAGCAATTCGGCTTCATC
TGCGGTGGCGCTGTTCTGCTCGTGTTGGTTCTCATTGCCATTTTCCGCAAGCGAAAGAATAGAAAGCGTGTGCACAAAAAGCAAGAGTAAATATCCCTTG
CAGTTTGCAAAGGGCATATACTACTACAGTAGTATCAGATTCACAATACAGTTGATGTTGCTTTTCAAATTGCCGGATGATAAAGCACGTTGAAACATAT
ATTTTATAAAGCCTTAAACTACGAGCCAGTTAAGCCACTTCTTGCTGGCACGCAGCATCTTGGACCCCCTTGTCCTCCGTGTCTCCTGGTTGTTGCCGGC
ATTGCATATAATACGGCAATACCAGATGCTTGACGAAGTTCTTTACTTCACATGTGCGGATATCTTCATCCAGCACATCCTTGTCATATCCAATCTGCCA
TGCGAGGTCTTCACGCGTCGGATCCGCCGCCAATTCCTCCATCAAGTCAACGAAGCGGTCGGCATCCTCCAAATCCGTGAAGAAGCCCAACTGAGTGTTC
ATCTCACGACGGCAGTGCAGTAACCGCGCCATCTCGTGCAGGTCGTACTCTGGATGATATTGCAGTCCCCAGAACTCGCCCTTGAGGTATCGGAGACAAA
CACTCTGCACCGTAGTGAACGAGTTTGACGCGAGCTGCAGACCTCCAGGCTGGATGACTCGGACTTCGTCTTTATGGCTGCTAAAGGCGTCAAACACTGA
CGGCTTGCCCGCGTACATCGGGTGTGCACGCCCTGCAGCATTAAGGCGGATCTTGCGTGCCACACCCAGCTCTTTGCCCCATTTGTTCTTTTGCACGACA
CCACCAGCAGTGGCCACAGCTAGCTGCAGTCCAAAGCAGCTACCGAACTGTGGCACGCCGTGAGCGAAGCTCTGACGGGCGAGGTTCATCATCTGCACCA
CCGACGGATCGTCACGCTCGTGTACCGCCAGAGAAGACCCGGACCAGCCCACGCCATGATACTATGCGTCAAATGCAGCAACAAGGTCAATTAACATTGT
AGACTTCAAAAATAACAAGAAATTTGCCTCACCTTGGACAGATCTGGTGTCAGGAAGCCCGGATCGGCGGGGTAGATGAGATCGTACGCTGCAGAGCGTC
CGACGCTACGTTCCGTAGCCTTGACAAGCATGTTGGCGTACAATTGACCGGCGGTGGTGGCGCCACCAGCCTCGAGGACGTCTCGGCCCGTCTTGACATA
GCCGTCGATCACCAGGTATCGAATCTTGTCATGATCATCAAGAGTCGCAGTCGCACTCGTGTGCAGGAGCTTGGGCTTGAGCCTGGAAGGTTGCTGCAGC
GAGCGAGCGGCCACGCACCAGAGCATCTTGTTGGTGAGTGGAGATCGCAAGAGAACCATGAGACGCCACTCGACCTTGGTGACAAATGGCGACGCGCCAT
CGAGACCTTGACCTGATGGGGATGCGAAGGGATGCGGTTGAATTATCAGCGAATCAGAAGCGTTGGGTGGCACTAGACAACGGATCTAGATGACGTTGCA
GATCACTTTGACATTCGCCAACAGCTCCTCATTCTGGATTCCTAAATGTTTCGCTCCGCCACCCAGGTAGATTGGCGACTTTGAATCTGGGAGATTCCTG
TCAGTGTTCTCACTGTTATTGCTACAGCTTGCAACATCCTCTCGCCAAGTTGCCAAGGTCTCTTCCCAGCGTGGCTTCGCTGCGTCCGCGTACGGTGAAA
AGCAATTAACTTTAACTGCATTGGATAGTTGATAACATTACTGGTCGTTTGTGACAGATTGAAGGTGGACAACCCATACACGGGTGAAACCTTCTGCGAG
GTTGCCTACGACTCCAAGGCTGAGGCGCACGCCAAGCTCGATGCAGCCGTGAAGGCGCAGCTGGACTGGAAGAATGTGCCGCTGAGCGAGCGCCAGGCAC
TGTGTACCAAGTGGATTGACGCGCTCAAGAGCAGCACCGAGTCCATCGCTTACGAAATCTCTGGCATGATGGGAAAGCCCGTGCAGCAGGCACGCAACGA
GGTCAACGGAACCATCGACCGTGTCAAGTACGAGATGTGTAGTGCTGCTGTAAGCCTTGTTTTTAGGCTCTTCTAACCAAATTTGCTCTGCTTCGTAGGG
CTCTTATCTACCTCTCGAACAAGGCGCTCCGAGCGGACTCGTTCCCGGAGGAGAACGGATTGTTCCGTCAGATCACGCACGACCCTGTTGGCGTCGTCTA
CGTCATTGTGAGTGGCTGTGCAGCTTTTGGCTATTGTTTTTCAGTAGTCGATCCTAACACTTTGCAACTGAAAACAGGCCCCGTGGAACTACCCGCTCAT
GACGGCTGTCAACTCAATCATCCCCGCTGTTCTAGCTGGCAATTCGGTGTTACTGAAGCACTCGCCTCGTACTCCTCTGTGTGGAGAGCACTACCAAAAG
ACATTTGAGCAAGCGGGTTTCCCGAAGAACGTGCTTCAGTCGTCGCTTGTTGAGCACGACACGGCTTCGGAGATCATCCAGCGCCCAGAGACCGCGTTCG
TATCGTTTACGGGCTCTGTGCGAGGGTACGTTTGGCAAATATTTCAACAGTAGTTCTGCTCTCTAACAGCACGCACTCTCAATTACAGCGGCCGTCAAGT
TCAGCAGGTAGCATCCCAGCGTTCGATCGACGTGACATTGGAGCTGGGCGGAAATGTAAGATGACAAACTCTTGGTCGCTGCTGATAACCATGCACTAAT
ACCTAGCATCAAAATGTATTTGTTGTAGGACGCTGGATACGTGACTGCCGATGCAGACGCTGAAACTGCAGCAGAAGGTCTTGTGGATGGCGTTTGCTAC
AACGCCGGCCAGTCGTGCTGTGGCGTGGAGCGGATCTACGTCCACGAGTCCAAGTACGACCAATTCTTGGAGAAGGCGAAGAGTTTGTTCGAGGCGTACA
ATCTTGGTAACCCGACGGACGCGAAGACGTCGATGGGTCCGATGGCGCTTCCTACTGCACCGGAAATGCTCGATGTTCATGTGAAGGACGCAGTGGCAAA
GGGTGCTCTCCAGTTGACGGGTAGCGGAATTGTTACTGATGCTGCTGGAAAGGGTCGCTTCTACTCTCCTACCCTTCTAGCGAACTGCAACGGCTCCATG
GACATCATGACGGAGGAATCCTTCGGACCGATTGTCGGTGTTGAACGCGTTTCATCGGATGCTGAGGCCATCAAGAAAATCAACGACAGCAAGTACGGAT
TGACGGCGTCAGTGTTCACATCAGACCGCGAACACGCCATGGCTCTGGGCTCGCAGATCAGCGCTGGTACAGTGTACATGAACCGATGCGACGTGCTGGA
CCCCTACCTCCCCTGGACTGGCAACCGCGACTCTGGCAAGGGCATCAGCCTGTCCAAGCACGGATTCCGTGGCGTCACGAAACTCAAATCGGTAAGTGCA
TCGCAACTCCATACGTATTTGTACTCCAGCTAACAGTACCCTGTTTGGTTTGATTTGAAGTGGAACTTCCGTGTTTAAAGGGAATCCGCCTACCGAATGC
TGCTTTTACATGGAGAAGGATACTGATAACACTGTTACCAACACGTAGCAACGTGATGAAACCAATCGACTTGCTGTTTGCTTGGATTCGGCTCAAACAG
CAACAAGTCACATCGTTATTTTAGATTTCGTACTGAAGGACCGTGTCTCGTCGACTAATGTAACGCGGGCTACATGTTTTGTGTGTTAGAAAATGATTTC
TCTACTGTCGTTCTCAAACCTACGTGGAATCCATTGGTTCCTTCCTCTTACACCTCGCTGGGGCCTCCGAAGGGGTCCACTCGTCCCTCGCTCGTCACGT
AGGCAGACGTAATGCCGCCGTCAACAACGAAAGACGTGCCAGTGATGTACGACGCGTCGTCACTAGCCAGGAAGAGTGCAGCCTTGGCCATCTCAGCAGC
CTCTCCAAAGCGACCCATAGGCACGTGCACTAGACGACGCTGCTTCTTCTCCTCCGTGTCCAAGAACTTCTGCAACAGTTCGGTATTGAGCGGACCGGGG
CACAGAGCGTTGACGCGAATGTTTTCACGGGCGTGGATCGTGGCTAGCTCACGGGACATGGCGATGACGGCGCCCTTGCTGGACGTGTAGGCGAGCTGGG
GCGTAGCGGCACCCAGGATGCCCACAAACGAAGCCGTGTTAATGATAGAGCCACCGCCGGCACGCCGCATGGCCGGGATACCGTACTTGCAACCGAGGAA
GACGCCCTTAACGTTGATGTTCATGGTGAGGTCCCACACGTCCTCCTGCGTTGCGATAGCGTCGTCGTCGGCGCTGTGCATGATGCCGGCGTTGTTGAAG
AGCACGTTGAGGGAGCCGAACTCCTTCTCGGCCACGTTCACCATGTTTTCCACGTCGCTGGCCTTGGACACATCAGCCTGGACAGCGAGAGCCACTGTGT
CGCTCTTGCCAAGCTTCTTGAGCTCTTCTTGCACAAGCTGGACGGTCTCAGCCGCGGCGTCGGCGTTCACGTCGGCGCACACGACGCCCTTGGCACCCTG
CTTAGCGAACAGGATTGCCGACTTGCGGCCGATACCGCCGGCAGCGCCCGTGACCACGGCCACTTGGCCTGCAAGTCGACTTCCGATAACACTCATGGTG
GAGATGGAGGGGTTGCTGCAGGAGATACGGCGGGTTTGACGCACTTACGATAATGACTGCAACCCTCAAGGTATCTTGATTGGTATCAGTCTACAGTCAC
CGGAATATTTTGTGGTGCACATTTTTGATGAGGTGATGGGGCGACGCGTTCAACGTCACCCAGATCCGAATGCTCGATTGATGAGATCCAGTGAGGATGG
AGGAGGGATTCAAGCACTGCTGGCTGCTTGCTGTGTGCTGAAAAACCAGGCGACTCGCCTCCCACCCAGTGTCATTTGCTTTTGGTTTGAGCTTATGTTC
AAGACAGCTTCGTCAAGCCCAAAATGGTGGTTAATTTTACAAATATTTATAGAAAGTGTGTCGTTTTTTCTGCCGAGCATATTTTGTTCGTCATGCAACT
TGCCCAGCGAACTATCGGAGTGTTGCTCATTGTGCACGAAGTACCGGAGTGTGGAATCCTTAGAACGTTCGTCGTCGGGTTCTCGTCTACATGCGCCGAT
TCGTGACGGTATGGCAATGGAGATGCTGTGCATGGATACCAGCTTGTACGTGAAATAACTTGGGACCCTTTCCAGTTGCATTGGCAATAAAGTAGAAATC
TACGTGCTTTACCTTGATAAGCATGCTGCATCAAGCAATAAGCCTTGTTACAAGAATCTCGGCACTGCCGAGGCTGTCGGCAGATACATCCGCTACCCCC
ATATACAGAGCTAACCATTTTTATAAAGAAGACAACTTCAACATATATTGGCGCGGACTGTATCGTCATTGTGGTTCTTGTGTGCAGCAACTCATTTGAG
TCAGGCCCTTGAGCCAACCTTGTTGATCGCGCGTTATTACTAGGATCGTGCGATCAAGATGCATGCAACTTGCGTTGCAAATGGGCTTCGAGCGATGATG
GGATATTCGGTCGACTTCACTCCTCGAATTGCCTCGCTAAACAGGATGTCCATGTACATGTAGTCATCCACCAAGGGCAGCATTCACAATATGAAGTTCA
CACAGGACTAAACAAGTGATGGTGTTTCCTCTAACATTGTCGCTCGACTCGCTCCCGCCTGACGCAGCACGTGCCGAGTCGGCAGGTGGCCCAGCCGACC
CTCCGCCACCATCTGTACAGTTTCGTCACCATCATAGCGTCACCATCTGTACATTCAAACCACCGATCGTTGAAGATGTGCACTTCAACTTGCGCATACT
AAAATGATGTCGTGCACACCACCTTGTCAGTCTGGGTCAGCGAAGTCACTCACGCAACTTCTTCCAAAGCACCAAGGCCGTCTCCGCCATGTTGACTCGC
TTCTCCCGACGTCTGTGTCTTCAATCCGCTATCGCCTCGCGGGCCTTGAGCTCGGCTGCGTCGTCTTCCCCGCTGAAGGTGTTGGTCATCGATGGCTACT
CTCCCGAAGGCCGCGCCGATCTTGAAGCTGGAGGCGCTAGCACTGCCGGCAAGTTGTACATCGACCTGCTCAACAAATCGGCGCCTGCTGGTGTGGAAGT
CGCGTCGGATGTGGTATACCCCGCGGACAGCGACTTCCAGACCCCTGAATTATCCAAGGTGAGCTGCAAAGCTTTAGTTAGCTAGAGATGCAACAACAAT
TGACTGCTCTTCCGACGTTGACAGTATCACGCAGTGGCGTGGACGGGCTGCTCACTGACGATCCACGACGCCGAAGATGTGCGTGTTACGAAGCAGATTG
ACTTTGCCAAGAAAGTCTTCGAGGAAGGTGAGACTCTGTTACTCCTTACGAACTTATGGACATTAGAAAACTAACAAGAAATGCTGTCGCGGTTAACAGG
AATTCCGCAGTACGGTAGCTGCTGGGCGGCTCAGATTGCGGTGGCTGCTGCTGGAGGTCACTGTGGGCCGAATCCTCGTGGCCGTGAGATGGGCATTGCT
CGCAAGATCGAGTTGTCTCCGGAGGGCCGCGCACACCCGATGTTCGAGGGAAAGCCGTCGGTCTTCGACGCGTTCACGAGTCACAACGACGAAGTGACCC
ACATGCCTCCTGGAGGACTTAATCTGGGTGGCAATGACTTCACAACAGTGCAGGCTGTGGCAGTACGTCACAAGAAGGGCGACTTTTGGGCTGTGCAGTA
TCACCCGGAGTACGACCTGCACGAGCTTGCCCGCCTTACGTACTGCCGCCGAGCTAAGCTCGTGGGTTTGGGATTCTTTGCGGATATGAAGAGCGCCGAC
CAGTACGTCGACGACCTGGAGAACCTGCACACTGACCCGTCCCGCTATGATATTGCATGGCGCCATGGCCTAGACGCCGACGTCATGGACGAGAACATCC
GTCACTGTGAGACGCGCAACTTCATCAAGTACCTCGCGCTCCCTTACAAGGCGGCGATTGAAGCCAAGTAAACAGAGTTCGGTAAAGAGATCACAGGTGT
CAACAGATAATGAAACCAATAGAAGGTGAGCTTCATGATTTAGTCTGGGGTTACATTTGTCACCATTTCGTTGAGCTAATAGCGATGCGTGGCCAAGACA
AACAAGAATAGTCACGTTGGTAAAAGTACACAATGGAAGACAGCGACAGCGCACAAATTGATGCGCAGTCGGTCTCAGTGGCGTCCTGTGGCAGCCCCAG
TGAGCCCACACAGCGTGACGCTAGCCTGCTCTTCTCGCTTCAAATTTACGTCGAAGGGGTCACGTTAAACCTGGTATCACCGTTTGTATCATCTTCCAAC
CCCTTGCTTCTAGCTTTCCAATTGCTTCAGTACGAGATCGTCGTTTTTGACGATGCATTGGCTTGTCCAGAGGCTTCTACTGCGCAGATCGAACCTGTAG
AGATGAAACTGTGCCATGGTAAATCTTGTCTCTTCGAAGCGAATCCAGAAGAGCTCCTGTGCGAACTGAAGCGAGATGCTGAAGCGCCACTAACACTGCT
ACTACTAGCTAAGGAGCATGGCAGGGCCCGACTCCGAGCTTTTGCTGCTGTGCCTTTATCTCTAGACATTGGACTGCTGGATGATGACGAGCTGAGCGGA
AGCAGACTGCTCCGTATCTGCGAATGGGCGAGTCACAGCGGTTCATGGGAACTCGGAGATCACCACAATGTAGGCGTGGGCAGTGTGACTGCAGTAGTCA
CACTGTCGTGTCTGGGAAAAGCACTAGCTCCACACCTGACGCAGGCACTGGGTGTTCAAGTGAATAAGTCACAGCCGCCAAGTCTACTCATGGAGAAGGA
GACGACGGCGGAACCGGCGACTACCGAAAATGTAGACGAAAATGAGTTGAACGAGAACCACGCCACAGCGTCGGATACAGCTGAAGACAAAGTCATGAAA
GTAGACAAGGAAGTCGAGAAACAGGATTCGAGCGTCCAATGTGATGAAGATATGCTCGTTGAGGATGCGAACGAGTCGAGTATAGTATCGCTGAACTTGC
GAAATTCTAGCAACAAATGTGGTGACGCCGGAAAAGGAAAATTGGCAAAGACGAGAACCAAGAATCCTGGCATTGGCGAGCACATATTATACTACAGGAG
AAGTTCAGCTCGAAAGGATGCGTCGAGTCCACAGCACATTCATCATAGACTCATTCGAGACCCAAACTCTCAGCGAAACATGCGCGCCGACGTTATTAAC
GACGAACTGTTATTCCCGCGAGAACTTCCTCCGCCGCTTTTCTTCAAGAAAGGAGCTAAATCGTAGGTCTACCGGCTGTAAGATTGACTCCCCCATAACG
AGAACTGATTACCAAGACGCGATCTGAATTAGGATATCCTTGGGGCTGCACGAAAAATCAATCGCAAACTCAGGATGTACTCATTGAGGAAAGACGATGT
TCGGCCACGATGATCCTTTGGTGACTCTGGGGATATTGGTGGAGGCGGCTCGGTACTTCGTGTTTGGAATTACCGTTGCCGTGTCTCGATCTGGCAGCAA
CTGCTGAACAATACAACCAGCGCTTAGAGAATCAAACAGCTAATTGAAAACCTCACATGTTAAATGCACAACCTGAAGAGCTCTCAGGAACCACAAAAGA
CGAGAAGAGAAGAGTTCATGCGCAATGACAACGTGTTGTGCAGTTGGCGAGATCGCGTCTGGTTACTCGTTATCTACACGATACCTGGATACGCTTACTG
CTTACCACCTTTCTTTTTGGCAGCCTTCTGCATCTTAGCAGCCTGCACGTTCACCTTGACTTCGCGAGTGAAAGGCAGGTAAGTGACGCCACCCATGAAC
GGCACCAGCACCTCCGGGACCTTGACACCATTCTCGTCCTGGAAGTTCTCTAGGATGCAGCAGACCGTACGCGTGGAAGCGCAGAGCGTCGAGTTGAGCA
TGTGCACGTACTTCTTCTCGCGCTGATTTTCCTTCTTGACGCCACAGCGAATCTCCATGGCACGCGACTGGAAGTCCGTGCAGTTGGAGGCCGACACAAG
CTCACGGTACTCCTTGTAGGCAGGGAACCACGCCTCCAGGTCGTACTTCTTGACAGCGGCGTTGTTAAGCTCACCCGACACGATGTTCACCACACGGTAG
GGCAGGTTAAGCGACTGGTAGAACTCCTCAGCGTGACGCAGCATCTCCTCGTGCATAGCAGCCGAGCTCTCCGGGTCCGTGATGCAGAACTGCTCCATCT
TGTCGAACTGGTGCACGCGGAAGATACCCCACGTGTCCTTGCCGTGCGAGCCGGCCTCCTTACGGAAGCAGGTGGAGAAGCCACCGTAGCGAAGAGGCAG
CGAGCTCTCCGTGAGCCACTCGCCCTTGTGATAGCCGCAAATGGGCTGCTCAGACGTAGCAATGAGGTACTTTTCGTCCTCGCCAATGACCTTGTACAGC
TGCTCGTCGAAGTCGTCGAGTTGCGCGACAGCGGCCATGCCTTCCTTGTTCATGAAGAAAGGGGGCTTGAGCATCTTGTACTGAGCCTTCATCAAAAAGG
CCGTGGCGTAGGCCATGAGCGCCTGTTCAAGCAGGAAACCGTAGCCCGTGAGGAAGTACGCACGGTGACCAGCCACCTGCACGCCGCGCTCGGGCTCGTA
GCCGTCGATACGGTGCAGAACCTCGTGGTGGAAGTGCAGTCCATCCTTCTGGAGGGGCGTACCCCACGTCTTAACCACCACGTTGTCGTCCTCGTTGTTT
GAGATGGGCACGGTGGGGTCCACGGTGTTGCCGATCTTGGGCAGCTCCTTGTCCACGAGCTCCTTGAGGGCGTCGGCCTCCTTCTTCTTCTCAGGAAGCG
AAGCGGCCAGTGCCTTACGCTCATCGCTGAGAGCCTTGAAGTCCTCCTTGGCCTTGCTGAGCTTCTTAATCTCTTGCTGCAGAGCGTTCATCTTCATGCT
GATGGTCTCCACCTCGCCCTGCTTCTTACGCCATTGCTCGTCCAGCTCGATCACCTTGTTCACGATGTCCACGTCCAGCGAGCGCTTCTTCTGGTCAGCG
CGCACGGCGTCCGGGTCGCCGCCACGCTCAGGGCGCAAACGGTTGATATCAATCGGCATCTTGGGTTACTACTTGGCTGTGGGGTATGTCCACGTATGAG
CCCGAATAGGAACCATCGAAGGGAAGATTCGCTAGTACCACCGAATTGGGTTGATTTGTGTAAAATTGGTGACATATGTGGGCGTAACTTTTAGTTAGAA
ATGCAGTTTCAACACTGAAGATCGGTTTAAACGTCGTAAATTTCATAAAAAGCCGCTTCAATCATCGACATTGGTGTCGTCAATCACAACAGAGTGCCTC
GCTGGTGGTGGCGCTCCTGCGTGGTAGTAAATCGGTCCACGACGGTATTCGCGTTTGTTGCGCCCTTCGTGAGAGCGGCCAGATACGAGACCAGCAGCGC
GTCGTTGTATTCTTGCGTAAACGCCGCATCGAAGTGCTCAGACTTCATCGCTGGCAGCTGGTTGCAAATGCTCGAGATGTGGCGTAATAGGTTGTGGTCC
AGAGGTGCCTCGCCAATCTTCATAGCCTGCAACAAACGCAGTAGCACATCCACCTGCCGGTCCAACATTTTCACAGCGTCTCGGACGTTACCCAAGTAAG
GGTGTACTACAGCGATTAAACCAAACAATACGTCAATACAATACCAACGTAGCTGCTGAGGCAGCATTAACCCGAACACGTACACGACGACTTGCTGGCA
TCACCAATAGGTGCGATCTTCGAGATATGGTCGATTGCGATGCCCTCCGTCTCCGACGTCTCAATTTTAAATGGTGCCTTGACGAAGATCATCTTGGGCA
CGCCATTGAGCATGTGCAGCTCCGACTCGAATAGCGAGATCGGCAGCTTCTTCTTGGTACTTGGTCCCTTGGATTCTGGGTCCAGGATTATAAACAGCGG
ACTTTCATTGAACTCCATGACCTGAAGCAAAAAAGCGCAGTTAGTCAACCTACCAACAACCATTCTACCAGCCAATACTTACGACGCGGTGCACCGCCAG
ATCACTGGGAAGAGCCTTAGCGCCGACTGTGTACCATCCGAGCAGCTCAAAGCCCGGGAAAACCTGCGAAACTGCAAAAAAGCAGTGTCAGTACCAGGCA
TGCAGTCCTTTCGAAGCTACAAGACACGCACACTGCTGGATGCGCGAGGTGAGGAACTCTTTGTCGATCTGAATCTCTCCACTAACGACGTCGTATTTCA
TCTCAAACGAGTCGTAGACGTCCACATCCAGACCTTTCTGGATACCAAAGAGCGCGCCGATGACCTGCGGCGCCTCCGTTTGGCTCAGCTGCGAGTTGCA
CTTCTGCCGCGTTTGGTGGTCCGCAACATTCACGATCACCAGCGGGTGGATCTGGATCTGCCGTTCGCCACCGCCACTTGCGCCTCCATCCTCGCGCTGC
ACCAGCATCTCCTCGTCCTTCTCCTCGGTGCTCGTCATCTCGGTGTCGTGCATCCTTCTTGGTGATGTTGGTCGATCCTTTGATTGGTGTACCGTTCGGT
GGTAGTTGATGTTGCTCACTTCGTTCGGTGGTAGGAGTGGATCTGGATATTCGTCCTGTCGCTACACCTTACGTAGCATTTGTGTACTGCACTTGCAATT
GTCGGCGTAACGTTTGCACGCTCTGACTATTCCGGTAACGCTCGAGCTCGTTGAGCAGACAGAAGCTCAAGGAATCTGGGCACGCTGAACCAACTCCCCC
CTCCTCCAGTTGTAGCTCGCCAAGGACCGTCACACTTCGGAAGCTTACCACCGCCACCTGCAGTCGTCATGAGCGACCAAGTGTCGGACGATCTGCTCTG
GTCCCTGGACGTACGACAAGAACATCATTGAAACATTTCTTTATTTATTCCACTAACTCTCGATATTTGTCCGTTATCTATTTATGCAGAATCTCATCAA
GAAAGATGCAGGCGCCGACGTGGAGAACGACGCTGACCTTGTGCGAGCAAGCATTTACACGCAGGACAACTTGCTGGGCTGTTCCATGATCGGCAGCGAT
ATGGTCTTCGGTGTTCGCGAGTCGGTCCGATTGGCGCCTGACAACGATAGCACCATGGGAGGCTACGGTCGACCTACGGGCTTAATGGGCTACGGCATCG
ACGAAGACGAGCTCGACGACGACGAGACTATCGGCCCCATTGAAGAACGCACTCCCGCGACTTTGAGCGTCACGCAACCCAGCAGTGGCAGCAGCTACGC
GAGACAGTCCTCGAGTCAGCGTAGTATCAGTGAAGACACGGACAGGTCTCTCTCCTTCGCGTCCGAGGGCGAACTCAGTGTCGACAGCCTCTCGGCGCCC
TCACCGCATCGGAAACGTTCGACGAGACGATTGAGTGATGGAGATCAGAGCACTTATGAGCAACGCATCGAGGCATCGTTGGCTGGGTACATCACCAAGT
CACTGAATGTCGAATCGCGGCTGGTTGCAGAGATGCAACCGGATAGACCTTTCACTATGAGCGATCTTGCTCATTTTAACCCACAATTTGGACGCGAGGT
TTACCTGGAACGACTAGGACAGAGTCTGCAGGATCAGGAAGGCGGAGCGAAATCGCTGGGATCATATCGTAGATCGACCATGCAGCGGATGTCCACACCA
GAAGATATTATCCGACAGGGATGGCTTTCTAAACGAGGTGAAGTGGTCCCGAGCTATCGAAAACGCTGGGTTACGTTGCGTCGGATGCCGCAGGGCCCGA
TGCTAACATACGCCAAGGACGATGCTGAAGGATCACCAACTAAAGTGATCGATCTAAGCTCAACGTCGCGTTGTGTGGTCGCCACAGGCAAAAACGCAAA
GGAGAATGAATTCAAGGTCATGACCTCTGCAGACTCGTCGCGTCGGGAATTTGGTATGGTAGCATCTTCCAGCTACGACATGACGCAGTGGGTGTGTGCG
ATCCAGAATGCTATCAACTCGGGGAATTGCTCGACATTTGACGGTGCCACCGACTTCCAGCAGCTGTGGCGTGAAGCAGGAATCCAGGGATTCCTAGTTC
GCTACGGTGTGCGCAAGTGCAGCTCACGGAATCGACTTCAAACTAGAGTTCTTGAGCTGAACTTTGCAGAGCAAACCCTTACGAATTCGCGGCGAGGAGA
GACCCTGACGACATTTCATTTTACGGACATACGTGGTATATCGGCGAGCAGCGTTCGCACCAGAGGCGAGGAGCATGGTATTAGCATCGATTTTCACGGG
CGGCATCGATCCTGGCCGATTTTCCTGGACACTGTAGAGGCACGAGATGATTTGTTTGCGATCTTGCAGCGCATCGTTGACAATGTGGTAACTGGCGAGG
ATCTTGAGAAGCGTTCATCTCGCTTGACACTCAAAACTGGCCATTTGGAGACAAAGAATGCTGGACCCCACGCCACTTTGCGAGGCCGGTTGTTCGTCTG
TCTTCACGAGAACTGTATCGTGTTTTACCCAGCAGATGGAGATACCAGTACGCGGCCATGGTATGTTATTGCGCTTAAGGGTCTTCGTCTGTCGGTCCGA
GAAGAGAAACGCCTACTTTATATTGGACGTCTAGCACTAGCGTGCCCGTCCACTGCAGAGTGCCGCGCCTGGTACGATGCCATCTCAGCTGCCATGTGTA
TGCCCTCAGAGATTATTGAGATCGAGCTGAAAGAGCGAGCGAAGATCCGCACTGTGTTCCAGTCATGTGTGTCTCGGCTGCGAAAAATGCTCAAGGCTAA
AGTGACACCCGAGCCGAACGGACCGCCGAAGGATCAGAAGACGGTGAACATGATGATCACTAAACTCTGGGAGCTTGTCTTCCCAGGGGAACCGTTCACA
TCAAATAACGATCCGAAATGGCTCGAGGTTGGCTTCCAAAGAGGAGGTCCGGCATCTGATCTTCGATCCAGCGGGCTGCTTGGCCTTTACTGTCTCATTT
TCTTTGCCAGTTATCCATCAAGTGAGTTCCAGCGGATCCTGAAACGCACGCGACATGGTGTGAGTGAAGGCAACATGAAGAACTATCCTCTTGCAATCGC
ATGCATCAACGTGGCGTCACTTTTGACTGAAACACTCGGTTTGGGCGACGCTGGTACGCACTCGGAAGGCTGTTCACCGAACGCGATGAAGACATACAGC
CGTTTGATTGCGCAGAGTGTTTCAAAGTCAAGGTCTTCGAAACCAGCCAAGACTTATTCGTCGTCACGGCCTCTAAGTGCCTACGAGTGCTGGGATGATG
TCGTCAACGAGCCAGAGAATCACGTGTTCGAGACTATCTTTTGCCTGCTCTTCCCGGTTATGGACTCACTTTTCGTCGAAATGGGAGCGGTACGTCTGCC
CGTGTTCAAGTGAACATTTGCTTGTATTATTCTGATGTCGGATGTTTTAATTGTACTGCAGGGATATATGGAGTTTGGACAAGTGACCGTCGCATTCCGA
CGCCGTGTGAACGAGATTTTCAACTCGCAGCCCAAGTCGTTGAAGGAGCTACAGAAATTGGCGAGCGAACCTTGCACAGGCACGCTTGCAGTGCCGACGG
TGTTGAGTAAGCAGCACAAAATAGGCAAGATTAGTATGGGCAAGAAAGTAGTGAAGGCGGGCGGCATGTAGTGTGACGAAAGAAGTCAACTTTGCCACCG
CCCACATAGAGATTGTGAATTTGTTCGGCTTGCACAGCGATAGAAATGCCATGCAATTTGCGCGAAGGTGTCGTGAAGCCATTGAGTCTGAAGATATTGA
TGTCACGTGAGTCAACCACAGATATGTTTCTGCTACCATACATGGATCTTAAAACGTTATTTCCACCATTTTCTGCTACACGTAGGCTGTTCACTTTCAC
TTATACGCATTTACGTACACGAACGTCATGTTATACTACCCCACGCTCCACCGGCAGCGCTACTTGATCGTGGAAGTTGCGCCGAAATTGGAGTTCGATG
CAAGTGCAAATGTCGACCCCTTCCTCCTCCACGACTGGCACCACCACC