Description :
From Genome Similarity Track
Location :
Scaffold_13:187030- 188281
Sequence
1251 bases(100 bases per row)
GTGTCGCCGGCAACGTTTGCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTTTTCCAATAAACGAGAGACAT
GAACAGTCATCTCGGCGTAATTGTGCGAGTAGTTGTGCAAATACGCCGCTAGACCAAGAAACTTTCGAAGTCCTTTTATGTCGGTAGGCACCAGCCAGTC
AGTGATCTCCTTGATCTTTTCCGGATCGGGCCGAACGCCGTGATTACCCACGATGCACCCAAGAAGTGATATTTCGCTTGCAGCAAATATGCACTTCTTG
AGGTTGGCATACAACTTGTGCTCACGCATCAGTGTAAGAACCTTTCGGACGTGGAGTCGGTGGACTTCCAAATCCGTCTGTCCACCCATAGCCCGGATAT
GGACGAACACGTCATCGAAATAGCTAGGTGCGAATTCTCGCACAGATCTCAATAGATCCGTAACGCATCTGTTGAACGTAGCAGGGGCATTACTCAGCCC
TTGTGGCATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTTTAAGGAATATCCTTTCATGCATAAGGAGTTGATAGAACCCGTCCA
TCAGATCCATCGATGAAAAGACGGTACTTCTTGCCATACCATCTATAATGACATCCTTTCTTGGTATCGGGGTTTGAGCTGATAAGGTTGCAGCTTTCAA
CTTGTTGAAGGCATGTAATATCCGCCATCTTCATGTGACCTTTCGGACACAGAAGGTCGGAGAGCTATGTGGGGAAGTAGATTCCCTCACATGGCCCGCT
GCCAAGCGATCGGCAAAGAATTTGTCAATCGCTGGTACTTGTTCACGAGGCAATGGCCATTGCTTCATGACACAGTACTTTGAACCTGGGTTCCAGTCTA
TCTCATGACGATTACCCTATCCTTGGGTAGCTCGCACGGCACTGTTTCTGGGAGCACATCTCTGAATTCTGTCAAATCATCGTAGAGAGGATTTGTCTTG
AGCGATTCCCACGATTGGGACGTGTATCGCTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTAATAACCCTTTCGTTCTCAG
AGAATACCATTGCCGACCGAATATCGGTTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGCAAGAACAT
CTTCTGTTCAAGCGTGGGCAATTGAGTGATCTCTGAAGTTGTCTTCGGAGG