Description :
From Genome Similarity Track
Location :
Scaffold_624:187- 2065
Transcript NameFunction/comments
g15686.t1hypothetical protein

Sequence
1878 bases(100 bases per row)
ATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACT
GGTAGAAAGTAACAACTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTA
GGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTCAGTATACTTGCGGATACAAGTAT
ACTGAACTTAAGTTAAATACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTGAGTAGTGGGTCTAAGCAGACCCACTACACCTGGTAGCAC
TTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAA
ACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGC
GGTAGCAACGATGTTGCGAACGCTATCGCCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGACGGAACAGCGTGAAACCGCTGCTCGAACTTCG
GTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGG
TCGACACTGCCATTACGGCTCGACGTGTCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGATGAGCAAGGAGTTGGGCGTACGG
ACGCCGACTCACGGATCCTACGTGCTTCAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTTGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGG
GCGGAGTTCCTCGATCTGCAACAGGGCAAACATGACGTGCATGCTTACGCCCAAAGGGCTCGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACG
AGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCCGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGC
GCTCGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCTGATGCCACGACCGGTGGTGAGGCCGTCGGGAGGTCCC
GAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTATG
CCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAAACAAAAAACTAGAAAGACCAGCAGGCGCG
GGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGGTCGCTGCCTCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAG
ATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTACTCTAGTGGACTGTAGTGTGTCGAACAACTTTGTTCGACT
GCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGT
ATCGTACGCGTACGCTTCTCTTATCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTC