Description :
From Genome Similarity Track
Location :
Scaffold_255:18696- 20118
Sequence
1422 bases(100 bases per row)
ACGTCACTCTTTATGCATAAACATTCACTCCTTCCTCCTAATCCACCCTTCTCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTTTGAACTCACATCAG
CGGTCCTCCTCCTCCCGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCT
TCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCACC
TGGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATTCGTCCGTATCTAGTTCGCTTCCCTGGCCTCATGTCGGTGATCTTCTCGACTT
CGAACTCGTCGGCCTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGCACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGGTTTG
CGGCCGATCCGGGTATTCCTTGACCAACTTCAGCTTGGATGCGTGTACTTCAGGGAACAAGCGATATTCGGTACCTGCCGTTCCCAACTTTACAGCATGT
TTTCCTATCTTCTCGCTCACCCGGAATGGTCCGTGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCTAAATAAAGTCACACCCGCG
ATCCCACTTGGACTTGACGTGGACGGGCGTCTTCGTTGTGTCGATCTGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACTTGGGATCTGGCTTG
CCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACTGGAATGGCCGCTTCTAGGGTGGATTTGGAA
TCGCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGACGGTGTTCATCGCGAAGGGGAGTCGCTCTGCGTACTGATCCCAATCCC
TCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATCGTTTGCATCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGC
CCGCTGTCTCTGCCCCAGGATCCGGCTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTTCCGATCATGCCTAATCATCTCACTAGCCCCAAATCTT
CGGAAAATGCACTCCTCGTACGATTCGGCAATGGTTTGCGCAGTTCTAGATGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAAATCA
ACAACTCTGCGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGTTCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCGGGCGACTC
CCCTTCGATTGTGGGCCTGCCC