Description :
From Genome Similarity Track
Location :
Scaffold_92:18694- 21995
Sequence
3301 bases(100 bases per row)
ACAAGGCATCGCCGCCCTAACCGTCTATTGCGTAAACCGCGACAGAGTCGATCGAGCCGTAATGATGCCCAAACCAAAAAAACGGGTACGGTGCGGGAAA
ATGTCGACTCTCAGTAGGCGTGGGGAGCCCTACTGGGGAGGAACTAGGCTTTGTAGAGGCTCTAGGAGGTAGAGCTGAACAAAGCTTAGCCCCACACGAT
CTCGTGGACTGTTTCCACGAAACGTGAATACAAGTCAGGCTTGTTGGTTGCCTCGGTAACGGTTAAGGGCTTTGTAGAGCCGTGGTCAATTTTGCTTGAC
TATGGAGCATCGGGCAACTACGTCTGACGCCGTTCCCTTGAAGGGGGTCAGTAGCATGCTGAGCGCTGAAAGCGCATGAAGGTGATGTTATCACGGTGCG
CCTAGCAACGGGGGCCCGTGTCACCGTACCTAAAGTTCCATTGAACTTAGGTGTAAAGTTTTCAGACTTTGACAGCATTGAACGCTGTCTTGTCCTAAAT
TTGGACTCGAGATATGATCTCATTCTTGGTATGGTCTGGCTGGAACGCCACGAGCCATGTATTGATTGGAGGTCCAAGACCTTAGGCGCAACGCGCAATG
GTTTTTAGTGAAGCTTTGGAGAGTCATGAACCCGTCTTTGCTAGAAAAAAGTGCTATTGGCGCGAGCCACAAACTGATTCAGTTAGTGGGCTGGATATCG
GAATGTCTGAGTTAATTGACTCTGATGTCAATGGCAATAGTGAAATGGCACGTATTCCGTTGTGTGGCACTTGTTGTTACAATGAGCCACTGGATGCTGA
TAGCATTGATGACCCCAGGTCGAGTCATTTAGGGTGTGATTCCTGATATATATGTCCAGTGGCGCGTGAAAATCCATATAGTTAGGGCGGCTGCAATAGC
ATCTCACAGAATGTCGCTAATGACATTGTTGGCGAAATGCCCCGGCATCAAGAGCGAGGCTCCTCTGATGTATGTGCAGTGGCACGTGAACATTCACAAG
GTGAGGGCGGCTATCATAGCACCTCACTGAATGTCGGTAATGGCGTTGTTGGCGAGACTTCCAAACATCAAGAGTCTGATGTGTGTACAATGGCGGATAA
CTCGCCGGGTGATGAGTTCGAGTTAAGTAACTCTGCAACGGATGTAGGTAATGACATCAGCTCTTGTTTAGAGCACGCTAAGGTTGAAAAAGCTAATCAC
CTTGTAGGATCAGATGTTCCGCCCTCACTGAGGAGTTCTGTCTCTTTTCAGAGACGGCAGCGACGCCAAGTGGCGGCTGCAAGACGAAAAGCGTCTGTAA
TGTCGCTAGCGATACTAGCAATTAGCTACATACACTGGTCGATGGCGTGACAGTTCACGTAGATGGTGAAGTTGGCATTGCGGCCCTTCCATCGTTGACT
GCTCGGTTAGAGCCAGACGAAATTTCTGCAGATGAGTTCAGTCAGGCCTTGAAGGCAGGCGATTTATCTGATATGGTGGTCCTTCGACCCGATGATGAGT
TAAACTCCTCGTCTCTATTGGATGAGAAGGTTCTTGAAAGTACAAAGGCGGCACTTAGTGCACGAAGTGGGTCATCTATTTTGACGTACCCTTTAGATCC
CTACTACCCTTTGGTTAACGAATTTCAAGACGTGGTATGCCATAATTTACTGTCTGTATTACCTCTCGACAGGGGCGCACGTCATGTCATTGACTTAGTC
CCTGGAACCAAATACTGCGTTACAAGGCAGTGGCCTTTTCCAAATGAACAATGCGACGTCATTGACGATTTTTCCAGTGCTAAGCACGCGGATGGAATGG
TGCGTGAGAACAAGTCTCCTCATTCCACTCGGAAATTTTGTGTCAAATAGCATAATGGTAAGTGGCATGTTGTGCATGATTATAATAAGCTTAATGGGGC
TACTATTCCGGCACAGACACCCATTCCTCGCAAGGATGTTCTTCAAAACAACATGGTTGGTTGTACTATGTATAGCACATTCGAACTGGTCGATGGATAT
TATCAATTGCTCATTCGAGAGAGTGATATTCCGATTACAGCAGTGAGCACCCCGAGTTGTATGCTATGAGAATGGCTGATGATGCCCCAAGGGCTGTCTA
ATCCTCCGGCAACATTTTATCGTCTGGTGACGCAACGTTTTCCGCCCACATCGGGATTACTCACATGCGTACTTTAATGACATTTTTGTCCATAGTCGTG
CCGAACAAGGTCGGTCAGATGTTGACAACCACATTGGTCATTTGCGAGCCGTGCTCGAGTGCATGCGGACTATTAAATTGTACGCCAACGCGTCTAAATG
TATTTTTGGTGCAGAGGAGATTCCTTTTCTAGGATGGTTCATTGGCAAGCGTGGCCTTAGAGCGAATCCCGCTAAGGTCAAGGCTATAGTGGACTGGACG
ATTCCTAAGAATAAAAAACTTGCGTAAGTGGCTTGGCCTTGCCAATTACTTACACAAATACTTCGCGAATTATGCTGATATGCCTCGGCCATTAACTGAT
CTCCTTAAGAAGGACACATATTGGCGCTGGGACAACATCCATGCTGACGCATTTTAGTCAATCAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGC
CAAATCCTGAGTACCCCTTTAGTGTTGTCTGCGATGCATCCGGTTTTGCTATAGGCAGAGCCCTGTTACAAAAAGATTCTGCAGGCCGCGAGCGAGTTAT
CGCATTTGAATCTCGTCAGCTCAAAGCTGCTGAAAAGAAATATCCAGTTCATGACAAAGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATATAGAGTC
CATCTGCTTGGCTCCAAGCCATTCGTCGTCTATACGGATCATGCGTCATTACGCACGGCGACACAGTCGCCTCACCTCTCTCAAAGATTGGCTCGGTGAC
TTTCCTTCTTTGCGGAATATAACTTCGAGGTGAAGTATAAGCCAGAAAAACAAAATGTTTTGGCAGATGCTCTCTCTCGCTGACCTGATTATGAGCTTGC
TCATGTCACGAATTGGTCGTCTCCTAGTGAGGAGTTAATTCGTGTGGCATATCCACGGGATTCTCAGTGTGTGGCATTGTTTCATGCCCTTGGGAGTGAG
GAATACAAGGACTCGGACAGCCAATTATCGGCACGGTTGCAGGCCAGCCTACATCTATATTCCATCGATAATGGTCTCTTGTGCTACCGCACAGATGTAG
CGGATACCACTCGCATTGTTGTACCTCAAGATGAGGATTTAAAGTACTTAATTATCCATGAGGTACACGATACTGCCCTCAGTGGGAATTTGGGCCGGGA
C