Description :
From Genome Similarity Track
Location :
Scaffold_109:18694- 20532
Transcript NameFunction/comments
Phypl_g3319hypothetical protein
Phypl_g3320fumarylacetoacetate (FAA) hydrolase, putative

Sequence
1838 bases(100 bases per row)
TGCGGTAGTTGCTGGGCGTTCGCGACTCTCGGCGCATTGGAAGCCGCGCAGTGCATCGCCAAGGGAGACAAGAAAGTGCCCACGTactcggagcagcagc
tcgtgagcTGTGACACAAAGGACTACGGCTGCAACGGAGGCGCCCCCGTGTACGCGATGGAGTACCTTCGCGACAACGGCATCTGCACAGAGAGCAGCTA
CCCGTACACGTCCGTGGAGGGCAGCACCGCGGCCGCGTGCTCGAACACGTGCACGCCCACCAAGTCGGGCATCACAGACATCGTCCAGCTCAAATCCGGA
GATGAGAGCGCACTCCTCCGCTCcctgaagcagcagccggtGATCGTCTCGGTCGTATCGAACAACCCCGCGTGGAAGCAATACACGAGCGGCGTGATCA
CGTCCTGTGACCCCGCGACGGTGGACCACGCCGTGCTCGCGGTGGGCTACGACGCCACCTCCATCAAGATCAAGAACTCGTGGGGCACGGACTGGGGCGA
GGACGGCTTCGTGCGCATCAGCCGCAGCACGCAGGGCACGGGGACCTGCGCCGTGCTCACCGACATGTCTTTCCCCAAAGTGTAACCCCGCTAGCGGGCC
CCTCGTCTAAAATATACGTAAACTGTGAGTggtaatacatgtagtcaAGGCAACTTCAGCCGCCATCCTCTGATCTGATTGGCACCCTACTTCAACTTGG
ATGTCATGTGCACCACGCAGAATATTGTAGTCCACACACATTTGATGTCCGTCACACAACCCTCTGCATAGAACTGCCAGCCCAGTCGAGCATCGACGAC
ATAGCCCGAGAGCTCCGATCCGCACTGCTGATGCCCGCATTGCTGCGTCTCGTGCGCCTCCGCTCCGCCAGTCcccgcctccgcctcgccaTGAGCCCCT
CCTCGCGCCGTCTCgcctcgtcggcgccgcgcaAGGCCACGGCGCTTACgcgcttcgtggacgagaacggcGCCGTCCGCTGCGGCCAGCGCACGGACGA
CGGCTCcaccgcgctgctggtcgaggacgacgaccccCTGGGCAGCCTGCACTTCACGGGCGAGACCGCCagcgtggagaaggtgctggcgcccGTAGTG
CCCTCGCAGATCCTCGGCATCGGCCTCAACTACCGCCAGCACGCCAAGGAGACGAACATGCCCGAGCCCAAGTTCCCCGTGCTCTTCACCAAGGGCGTCA
ACGCCCTACAGAACCCGCACGACCCCGTGGTGATCCCCCGCATCGCGTCGGAGCCCCCCGAGGTTGACTACGAGTGCgagctcgccgtcgtgctgAAGGA
AGCTGCCTGCAAtgtgacggaggaggaggcccTGACCTACGTCGGCGGCTACACCTGCGCCAACGACGTCTCggcgcgtcgctggcagggcaagaagggc
ggAGGCCAGTGGTGCCGCGCCAAGACCTTCGACACCTTCTGTCCGCTGGGCCCGGTGCTCATGACGCCCGAGGTCATCCCGGACCCGCAGGCGCTCGAGA
TCGCCACGTACCTCAACGGCGAGCAGGTGCAgaagtccagcacgagcgacatGATCTTCTCGGTTGCCAAGCTGATCAGCCAGCTCTCGCAGGACTGCAC
GCTGCCCAAGGGGACGCTGATTCTCACTGGAACGCCCGAGGTACGATGCGAACTCGTGTTATATTGTTGactgtgctgcagctcttaACCTGCTTTGATG
CTGCGTGTTCGTGCAGGGTGTTGGTGTCGCACGCAACCCGCCGCTTTTCCTTGCGCCGGGCGACATGGTGGAGATCGAGATCGAGCGCATTGGCAAGCTG
GTGAACCCGGTTGTCGGCGCCTCGGCGCTGTAATTGCC