Description :
From Genome Similarity Track
Location :
Scaffold_34:18692- 22730
Transcript NameFunction/comments
Physo_344920Eukaryotic/viral aspartic protease, active site

Sequence
4038 bases(100 bases per row)
TATATTGGCCAGATCCAAGACCTTCCTAGTAAACTACCTGCAAGTGCAGATCCAAGATCCATCGGAGTTACGGTGCGTCCCTCTCGTCTCAACTGTCAAC
GACACCGTCATTGGAGGCGGCAAACACGACCAAGGAAGACCTGCGAAGGCAACGTAAAGGACAACAACCTCGAAAGGCAACAACCCGGTCGGATCCAGAT
CCAGGCCGCCAGATCCAAGTACAAGACCACTGGATTTGGAATATTACCACGAGCAGAGTGGAGATTTCCGCGCTGCTCCACCCACATCCCCGCGTCTCGC
CCAGACTGTTCTCTCTTCAAGGCTCGGACGCTTCGGAAGACACCAGAGGAGCAAGATCCAGGTAGGGCTTACCGACGGGTACACAAGGTGACCAAGTTCA
GCACACAGATCACGGATCATCGGGGGACCCCCTCCGTAAGTCGGTGTTCGGGCGCAGTTGGGAAGTTGGATTGGCAATCTCGCAGATTTTGCTGATCCCG
CTACACCACAATGGTTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGAAGTTCGAGTGAAGAAGGAACAAGGGGATCA
AGCGTCATCGGAGTCGGGATCGACGACGACGCTGCTGAATGAACCAAGATCCACGGATCGACAGAGTGCAAGGAGGACCTCTGTCGGCGGAACCGAGGTG
GATCCAGACATGGATCCAGAAGAGAAACCTCAACCTCCTCCACAGGTCCCTTCGGGGACCCCGGTGGATCGCGACGCGAGTCAAGTTCCACCAACAAAAC
AAACCAAGGCTAGCAAGGATCGGTATGCATTTGCTGATTCACCAGTTAAACCGGATGCCTACTTCTTGACAAGACCAAGTCGATGACACGAGCGAAGCTG
AAGGCCCCGGATCTGGATGACGAAGATTCAAAAGCGTCATCCCACGAAGAATCCGAGGAGGCAGGCTGGATACGTTACCACGAGAAGCAGCTACGTGACT
TCCTGGCTTGGGATCCCATGATGCGGCTGCTTGGCGTGAAGCCGATCGGAGAAGGGCCTGTGGCATTCCCTGCACCCGCCAAGCGTGAAGGGATCCTGGC
CGAGATGGAGCGACTCATGCAGCGGCTGAAGGAGGCCGGCCTTGTAGCTGGCGCCTTCGACGCGAGAGCGATCTACGACGCCGATCCAATCCAGATCCAC
GCGACGACGGACATGCTGTTCAACAGGCTGAAGGCGCTGGTAGGTGAGATCCGGATCCAGAAGTCCCGGATCCAAGTTCACCTCAAGCTGGATCCACAGG
ATGCCGAACGTCGTCACCATACGTGTCCGCCGCGGAGCTTGGGTCGGATACATCTTCGGAGCCGCGGCGTATGTCGCTTGGACCCTCGGGAGCCTCGATG
CTACGCGCCCGAGCCCAGATCCAGCGTGAAGCAAGCACTCAGCCCCGATCCCAGCCCCGACCCAAGAAGCCGTCGACTCCTTCGGTGGATCCAACAGCTA
CGGCATCAGGATCGAACATGTCGACTGGCAGGCTTGAGTCATACTTTCAGGCAGCCATGGGCAGGTTCTTGAAGGAGCAAGGCGTGTTGACCCCGACACA
GGCGCCGGAGGCGACGCAGAACGCCGGATCCCAGGACGTGGAAATGGAGTCCACTGGTTTGTCCGATCCAGATCAACACTGGAAGTACGATCCAGATGAC
ATCGACTTCCCGGTCCCAGCTCGCGCTACAGTGGCCACCACCGCGACCGGATCCACAGGTTCGGCCCTGATCCAACGAGTCCGGATCTCAGCGGTCTCGG
ATCTGAAGGAGTTCTCAGGGAAGGACCAGGATGAGGATCGGGCGAGAGCATGGATCAGTAAGGTGAAGTCTGCGTTCCTCCGTGACCAAGCCCCTGACGA
GGAGAAGTGCTTGACCTTCGCGGACCTTCTGTCCGGATCCGCGAGGAACTGGTATCGCCAACTACCTCGATCCACACGCAACAAGTGGTCGGATCTGCTC
CGCAGTTTCCAAACCCAGTACTGTGGATTGGTGATCTCCGTTGCTCGCCAGTATTACCACGCGCGCAAGCGATCCGATGAGTCTCCGCTGGATTATCTCT
ACCGACTTAATGTCGCTGGACTCCGCGCCCGACTCAAGATCAAGGATGGTGGATCCAAGTAGAAACGCGAGCACGTGAATCAGGTCATCGAAACTCTGGG
TGATCAGGATCTAGCGGATCGACTGACATTGCTCCGACTGCCGGATGCTGACGAGCTGGAAGAGGTTCTCCGCGCACTGGATCGGGCGAAGAATCGACAG
AAGAAGTCTGCGAATGGAGCCAGCAAGTTCCGCCAGAAGGCCCCCGCGACACCCGCACCGGCCGCTCCGGCCAAACATGTGCGTGCGATCCAGGTCCAAC
CTGACACGGGATCCGAGCCTGGATCCAGCGATGAATCTGACTCCGAGTGCGACGATTACCGCAGGATCTATCTGGCGGCAGCCCAAGACCACGCGAAGCC
TGCAGAGGAAGAGCAGAAGACTCTGGATCGAAACCTTCAAGACCGTCCGAAGCAGGATCCACCGTCTCGCGACTCCCGATCCAGGACGCATGTGGGGGGA
CCCGAACGTAGTCGATGCACGCACTGTGGATCCAAGCGGCACTCGCATCTTGCCTGCTGGAAACGCTTGACGTGTGAGAAGTGCGGCAAGAAGGGTCATC
CAGGTGATCACTGCCTTTTCGTGTGCTGTGGATGTGGTGAACTTCATGACGTGGGCCGATGCCCGAAGGAAGAGTTCTACAACCAGATCCGCCAGTGGTT
CAATCCGGCCAAGCATGCGGGGATGCTGCCAGAGATGGCGGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTGGAATCCGGTACGAGCCAAACGTTCTA
GGTATTGCATCTATGCATTTGTGAACAAGACATCGACAGATCCAGTTAGCAAACGACAGGATCTACGCGGTAATACATGTGATCTTCATGGGAAACGTAC
TGCTGTGGTCTCAAGTCTCTGACAAGCTGATGACTACTCAAGATCCGACACGACAGTGGAAATGGATTATGATCCGGAGGCACGTCAGGGATACTGGAAG
CAGCAGGATCCAGACCAGTGGTTTAAGCCTACCGAAGGTGAAGACACGGCTGGATCCAGATCCAGGCGTGTTGCTGCGAACCGGCGGACCACGGATCCAG
AATCTTCGTATCTCCTACCCGGAGAATCCCGAGGATACTGGAAACAACATTCGCCAGGGAATTGGTTCCGTCAAGCCAAGATCCACGGTAAGATCAACAA
TGAGAAAGCGATCTTAGTCCTAGATACAGGTGCCGAGGTGTCCATCGTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCTACATCGGCAGGAGTCAGAGC
CAAGAGTGTGTTGGGATCGGAGACAACGTGTATACAACGGAAGGAAGAACACGGATCATGATTACCTTGGGCGGATACCTAATGTATTTCTTCGACATTT
ATCTGGACAAGAGGCCATCCTCGGTATGGATTACATGATGCCGGCCGGGATCCGGCTGGATCTGGCCGACGGGACTCTCTGCCTGCCCGATGAAGTCCGG
ATCCAGCTCAGCGGACGCCGTCCACTCTACAGTGACAAGGCGCAGTCCGTGAAGCTGGATCGATACTTGCAACTTGGGATCGGAGAGTCCGCGGAGCTGC
CCATGCGTCTGCGAGGATCGGAACACGACAAGCTGTGGGTTACGCGAGGGGATCGATGGGTGCCTACGGTAATCAAGGGCCCAGGCAAGGTACGGTACCT
TCAGATCACGAACATCGGAGAGAAGGAGCTGGTGTTGCGCCAGAGCCTCCAAGTCGGGATGTGGCTGGCCGGAGATCGAGTCCCGCGGATCCAAGGTTAC
GTGTCCATCGGATCCCGCCGCTACATGGAGTGGCAGAACCTCGCGCTGCAGGCCACGACGGACGCTGGATCCACGGAGGCGGAACCCCCGGAGGCCCCAC
CAGGGCCTATGGTGGAGCGCCCCGAATACCCGACGCCG