Description :
From Genome Similarity Track
Location :
Scaffold_72:186907- 188781
Sequence
1874 bases(100 bases per row)
CGATGCCTGTTTCCCACCTTATCCTTGGGAAGGCCATACACAAAGGCCACACTCATGGACTGCCAACTACCCTTGGGGACAGCAATGGCGCTGCCATGGT
CGGCGCGGACTTTGTCCGTTGACACGTCTCACACGTGCGCCAACCCACTTATACATATTGGGCCACCCGTACATCGAGCTCACCGAGCCATAGGTCTTCT
CCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATATAAGGCTCGATACTTTAGCTCCTCATCATAAGGAACGACTCCACGAGGGTTATCCTC
AGAGTCGGTGCTGTAGTACAGCAGGCCACCATCGAGCGAGTATCGCTGCAGCCTAGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGCTTTTAAACACT
TCGCTCCCAAGAGCCCGTAACAGCGCTACGCACATGTCGTCCTGTGCATAAGTCAGGCACTGGCGCCGTCACTGTCGTGACATGAGCTAATTCGTAGTCC
GGCCTGCGCGAGAGCGCATCGGCCACTGCATTAAGCCGCACCGGCTTGTACTCTACCTCGAAGTTGTACTCGACAAAGAAGGAAAGCCATCTTGCCATTC
CCTGAGAGAGATGAGGCTACTGTGTCGCCGTGCGTAGCGACACATGATCAGTAAAGATCACAAAACAGGTGTACCCTGAACTTGACTAGAGCATTCTTCA
TTGCAGGTAGCTCTTTTGTCATGAGCTGGATAGCTCTTGTCTGCAGCTTTGCGCTGGCGAGACTCAAACGCAATCACGCGCTCACGCCCTTCGGCGTCTG
CTTGTAGTAAAACACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACGATCCGGGTCCGGTAGCACAAGGATCGGAGCCTGAAGGAG
GCTCTCCTTCACACCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGAAGATCTGATAATGGCCGATCCATATCCGAG
TAGTTCGCGCTGAACTTGTGCAAGTAATTGGCTAAGCCTATCCACTTGCGTAAGTCGTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCTTGACTT
TGGCAAGATATACCCGTTAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGATATATCCTCCGCGCCAAAGGCGCACTCGTCCAAGTTGGTATACAACTT
ACTAGTGCGCATGCACTCGAGCACCACTCGCAAGTGGTCAATGTGGCTCTCCACGTCTGACGTTCCGTGCTCAGCACGACTATGGGCGAATATATCGTCA
AAGGACGTCTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTAACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATGACTAGCC
ACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGCGGAATGTCGCTGCTCTCATGAGCAATTGGTAGTAATCATCAATTAAGTCGAGTGCGCCG
TACAACGTACAGCCTGCCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGGTTGCGCCGGGACGGTGGCCGCATTTAGCTTGTTAAATGCATGAA
CAATGCGCCATATGCCGTCCGGCTTTCTCTGACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCGCGGAA
GAATGCGTCAATGACGTCACACCGCTCCCTTGGCAAAGGCCATTGCATCGTTAAGCAGTATTTGGTTCCAGGAACCAGGTCAATATCATGACACATGCCT
CGACCCGGAGGCAGGCCCGTCGGTGGGTCCTTCGAGACAACGTCTTCATATTCCTTCACCACAGGGTGGAAGGG