Description :
From Genome Similarity Track
Location :
Scaffold_28:186873- 189547
Sequence
2674 bases(100 bases per row)
CTCAGTCAACGCCATTTGATCTGCTTCCGGTGACGACAGTGCAACCGTGCACTGCTTCTTGCTTCTCCAGATGATGCAACCGCCATTCATCATGAACGCG
TAACCACTTGTGCTTCGTCGAGTGTCCACGTCACCATCCCAGTCCGCATCCGAATATCCTTCAAGTACTTGTCGGTTCTTGGCTTGGAATTCGATGCCAT
CTGTCTTCGTTCCTTTTACATATCTGAAGACCTCTTGAGTGCCTGCCAATGTGTTGAGCACGGATCCGAAGCAAACTGGCTGAGAGCTCCCACTACGGCA
GCAAGATCCAGCCGGGTCCCAACCATTAGATACATGAGGCAGCCGACAGCATTGCGATATGGGACATGGGCCATGGTCGCTTCATGGTTGCATCCTCCTT
CGCACATGCTCTTGGTCAACTTGAGTCCGGGATCTTGCGGTGTCTTGACGGGGTTGCTGTTCTCCATGCCGAACTTCTCCAGTATGTCTGCGGCAAACTT
AATTTGACGAACGGAACATTGCCACTGATGAATTATTGATCAATCTCCGTGCCCAAGAATTACTTCAGCCGACCAAGGTCTGTCATCTCGAATCGCTCGC
ATAGCGCCTTCTTTTTCGTTTGGAGCATTTCGTCGTTGTTGCATTCGAGAACCAAATCATCGACGTAAAGAGCCACAAAAATCATGTCTTCGCCGTCCCA
CTTTGTGTAGAAACAGTGATCGGTCTTGTACTTCTTAAACCACATCTCGAGCATGAACTTGTCAATGGTTTGATTCCATATGTGTGGGGACTGCTTCAAA
CCGTAGGGAGAGCGCTTGAGCTGACATACATAGTCCGGTTCAACTTCGTCGATGTTACCGTCGGGCTGCACCATGTAAATGTCTTCGTTGGGAAGTCCGT
TGAGTAATGCTGTCTTGACGTCCATTTCGTGCACCGTCAACTTGTATCTGGCCGACAAACTGAGCAGGATCCGAATCGACGTGAACTTGGCCACCGGAGC
AAACGTTTCTTCATAGTCGACACCATACTTATGCGAAAAACCCTTGGCCACAAGGTCGCGCCTTGAATCACTCGATTTCGCCAGCTTGATTCTCCTTGAT
CCGAAAGCCCCATCGACAACCGATTGCCTTGCGACCTTGTGGAAGCGGCACTGATTCCCAAGTCTTGTTCTTGCACAACGATGCCACTTCGGAGTTCCAG
GCATCCTTCCACTTGGCTGCGTTGGTTAATTTCATCGCCGACTTTAACGTAGTTGGCAGTTCCACCACTGAATCAACAATGTATGCAGTTTCATAATCTT
GAGCCGTCGCGGACATCTCATCAAGCGATCGGTGAAGACTTTGTTTCTTGGCCCGGAAAATCTGCACTGCCTGTTCAAGCGACCGATTGCGTTGATGCCG
CTTGCTGCCAGGCTCAAAGTCGACGTCAGGTGGGGCTTGAGGCTGTGAATACTTGGTGTTGTCGAGCATGGGATCTTGATTGGACGCAGCGTCATCAGTG
TATTGGTCGGTCTCATCAGTTTGGTACAAAGTTTCGTCGACCACCATTTTATCTTGAACGACGACTGTGCTACTCTGCTTCCCGTGATCGAAGACGTCCT
CCATGAAACGAGCGTCACGACTTGTCATCACACGACGGTTCTCAATGTCTTCGAATCGGTACGCTTTTTCATGCTTGGAATAGCCTAGATATCGGCAGCG
TACCGAGAGAGCGTCAAATTTCGAGCGCTTTTGCTTAGGCACTTGGACGTACGCATGGCAACCAAAAACTTTCAGGTTCGCAACAGGTTTTTTTTGCCAG
TCCAAACTTGGTACGATGACATGTCATGACCGACCGCACGTGATAAACATCGGTTCCGGAGAAATATCGCAGTCATGACAGCTTCCCCCAATACGACTTC
GGCAAAACAGCGTACTCCAGCATGCAGTGACCACATTCGACCAGTGTGCGGTTCATGCGCTCGGCAATTCCATTTAGCTGAGGAGTGTAACGAAGCGTAA
TTTCTGTACAATGCCGCGTTCTGCACATAACTTGGCCATAAAACCAGAAGTATATTCCCCGCCGTTGTCACACCGAAGTGTTTTCACGCGCATGCTGGTC
TGGCTTTCGGCCAACGCAACGAAGTGGGATAATTTGTCGGCTACCTCTAACTTTTTCTCCAGCAGGTAGGTGACACAGTAATGCGACTTCTCGTCAATGA
AAGTGACGAAGTATCTCTTGCCACTGAATGTTGTGGTCTGCATCGGACCGCAGATGTCGCTGTGGATGGCTTCGAGTACTTCCTTGCACGATTTGGGGAA
TACTTCATGATGTTCATCCGCGTCTGCTTGCCGAGATCACAGCCATCACACAGTTCCCACTTGCGCACTGATGTCAACTTGATACCAGTGCCAAAGCCTT
TGGTGACGATGGTGGTAAGACCGCCATAGCCAATGTGACCTAGTCGAAGGTGCCAGAGGTACGAAGTGGTGTCCCCATGACATTCCAACGAGCTAGTCAC
ATTGGCTTCGTCCACCAAAAACGGCTCTATGCACAACTTGAATAGTCCTTTGCCTTCGCGCGCACCAAGCTTCCAACGAAGGCCATTCACTTCCGCGAAG
CACCCATCTTGCGTGAACGTGACCGGGCCAACATCCTTGGTGAAACGCCCCACGGAAAAAAAATTGCGTGACAG