Description :
From Genome Similarity Track
Location :
Scaffold_392:18686- 19688
Transcript NameFunction/comments
g8714.t1hypothetical protein

Sequence
1002 bases(100 bases per row)
TGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATATGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCA
ATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCG
ATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATTTGTGAGTCGTCGTCCGTC
CGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGTGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCG
ACAAGCCAACGGAGGAGAGGCCCCCCCTCTCTTCTAACGTAGCTACTTACGTGGAGTTTCAATGACTCCCGCGCGGTGTGACGGATGGCGACACCGAAGC
TCGAGCTGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGTT
TCTCCAATGACCGTCGACTGTCGTTGGAGGGCCCCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCATGCACAACATGCGTTGCAGACGTGTTTCGGC
TACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGACCAACAAGTG
CTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAAGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATA
CTTGTATCCACAAGTATACTTAAACTAAGACAAAGGAACCGAACAATAGCTTTGGTGCCAAATGAGAACTGTATAGATTGTAAATGGGGTTTCCTCCTCA
AA