Description :
From Genome Similarity Track
Location :
Scaffold_1667:1868- 4042
Sequence
2174 bases(100 bases per row)
AGGTTAATCGAATTTACTACTTGGTCGGTTACACTCTAGAAGATCTCAACTCTCAAGATTCCGTCACAGGAGGCGGCAAGTACGACGTAAAGGAAACGCA
AATGCAAGGGACACACTCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCTGAATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCAACC
ACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGA
GAGAGCAAGATCCAGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGAATCATCGGGGGGCCCCCTCCGTTAGTCGGTGTCTGAGCG
CAGTTGGTAAGTTGGACTCAGCAATCTCGCAGATTTTGCTGATCCCGCTACGCCACAATGGTGCGCGTGCCCAGATCTTTTGGTGACTCGGGATTTCACC
GTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGCGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAATAAGATCCGC
GGATCGATGGAGTTTTGAGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCG
GGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAA
CACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGA
AGACCAAGCGGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATG
CGGATCCTGAATCCACGTCAGATCGAAGATCCAAGGGAACCGGTAAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACGTT
TGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGC
CAGAGTGAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCATCCTCGAACTACGAATCCGCCGCT
GAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAG
TCCCCTGTGAACGTGAAGACTAGGGATCCAGTACGCCCTACCCGTGATCTGACCCAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGAT
TATCGTCAGATCAGGCTCGAGGTAATCGCTTCACGGATCCGGTCTCGCCAGTGGACCCAGACGGCCACAGGCCCTTCCGACACTTCCTCGGGCACCCTGC
AGCGGCACTTTGAAGCTGCGATGAATCGCTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGGGA
CGTGGAGATGGAGTCAGTAGAGGGGGACAACTCCCATGATGAGTTCGACCCAGACGATCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACGGCC
ACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCTATATCGGACTTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAG
CGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGC
CAGGAACTTGTATCGGCAGCTGGGCAGATCAACCAGGAACAAGTGGCCAGATTTTCTGCGCAGTTTCCAGACCCAGTACTGTGGATTAGGAGTGTCGGTG
GCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGTTGGAATACCTACATCGACTAAATGTGGC