Description :
From Genome Similarity Track
Location :
Scaffold_67:18668- 21226
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014619Similar to ATP8A1: Probable phospholipid-transporting ATPase IA (Homo sapiens)

Sequence
2558 bases(100 bases per row)
ATGATGGGGAGTGCCGTGAAAATGAGATTGTACCCTTGCTGGATAAACGCCGAATAGAGCATCGTCCCCGAGTACGCTGTCGCGAGCATCGCATACCAAA
ACATCGATACACAGTATACGACATTCTTGTAAAAAGTATACACCGTCAACGCCGCCACGCGATCATAGTTCCAACGCCCATGCACGAGAAGCAAGGGGCT
CAAAAAGCGAAATTGCCCCAGGGCATAATCGGAGCTATTCACTGCTTGCATTCCTTCTTGGCCACTGATACCAACGCCGATGTGCGCACTTTGAATCATT
GGGACATCGTTTGCGCCGTCACCAATAGACAAGGTATGCGAATCGTGAACATTCAACTTCACCAACTCGACTAATTGCGCTTTCTGTTGCGGTGAAACGC
GACAGGCGACAACGACTTTGCAGAGCAGCGACACTCGAAGCAAGTGGAGATTGTACAGCGGGTCTTCGAGAATCAAATTCAAGCAGCCACCATCAATGAC
AAGCGCATGTTCAACATGCTTTTTCATTGGAGTCCCCATCGATGGATATGTTGGAGTTGCACCATTAGTCTCATTGTTTTCGTCACCGTTGTCGACATCA
TAAATGGAATGAAACACCTTATCCAGCTGCCGCAAAATGGATCCTTTGGTACGATACGTCGCTGAGTTGATGACATGGCGCTGCATATCGTTGTTCAGCA
AACGGCACGCGTAGCCAATGTTAATGGCAGTTTCTTCCATGTCGCCAGTCAACACCCAAATGTTAATGCCGGCCTTTGCCAATTGCTCCATGGTTTCTGG
GACTCCATCTTGCAGGCGGTCTTCAATGGCGGTTGCCCCCAACAGGTCAAAACCAGATTCCAGTTCGTCTTGCAAAAGATCAATCGCGTTTTTATCGCCA
CGAGCTTTCGCTTCAACTTCCTGCAAGTCGGCCAAAGCGCGGCGATAACCCTCGTGGAAAGATTCCCAATCCTTCATTGACATCTTCTTGGAACAAATCA
CCAGAGTACGCAACCCGTCTTGTGCAAACGTTTCCAGGTCCGCCAGAGTTTTCTGCCGCGTTTTCGCATTCGTCTTGGACACGGAATCCGGGGCAAGGCG
AGGAAACAAGACGCTGTCGGCACCTTTTGTCAACACGAGCACTTCATCTTCATCATTTTCCGTCATCTGCATCAGTTCTTCGTCTGTCTTCCTGCGCTGA
ACGATCACTGTCATACGTTTCCGTGTCGAGTCAAATTCAAACACCTCAAGAACATCATACTTGTCAACCTTTCCGTTGGGCCGCTTCAGAGACACGCTGC
CAGGCTCACGGTCAATAAACTCGTAACCAAAGTACTTGGCGCCGCAAACAAGCGCTTGCTCATCTGGTGAGGACGCTGAATACTGGATAGGAAGCTCTTC
CATGCCTTCAGGCACCGTATCAATTCGTTCAATGAGGACTCCGTGACACAATGCCAAATGCGTAAAAAATTCCTTGATTTTTTCACTTTGCTCCTCTCCT
TCTTGAGCCAGGTGCTGCCAAATTCGACGGTCCTTGAAGTTCACATTTGGGGCAGGACACTTCACGAATTCATCATCCTCGTTCTCCGACTCATCATCCA
CATTTCTGTTGCCTTGGAAATCATCTCGGAGCCGCGCTGCTAAGCCAATTGCTGTAATACCTTTCCCGTAGCTTTGACCGTTGATGCTGCACTTGCGAAA
CTCCATTTTGTTGCAGGTCAGCGTTCCAGTCTTATCCGAAAAGATGTGCGAAATCTGACCAAGTTGTTCATTCAACTGCATGTTTCGTGCCACCATCGGG
ATATCGTTTTCTTCATCGTACATATCCAGGTCGCGTTCCATAAAGTACGCTTGTAGCGCCTTCACCAACGTGATAGACACGTAGAGCGTGATCGGAACCA
TAGATGCGAGCGTCGTGAAATAGTAGACAAACGTCCCCAAGATACTTTTGCTGAGGTCATTATCAATGTACGAAGGAATCGTTTGGTCGTGCATCCAAAT
GTTGTCGCTGATTGCGCCAATCAATGACATGAGCATCAGGAGCAGCACGACGATGATGACTTGCTTGTTGGTCATTTCATCGATCGACGACACCTTGACT
GGAAACTCATCTCCGGAACTCATCATAATCTTCGTATCGACACCAGTGTTGACAACTAATCCGTACACGAAACTCGTATTGCGTAATTTACTTCCACGAA
GGAGCATATTCTTCAGCGAAAGTGCGATCCCCACATCGGCATTGGAGTCAGTGTCATCCAAATACAGCGTTCCAGAGTATCGGTTGATGTCACCGTTCGG
GAGTTCACTTTCCACGTACCCTTGCATCACTTCGCCAGCATCTTCTTCGTTCACAAACATGCTCCGCGTGACTTGGGGCGCTTCTCGCAACTTCAAGTTA
GTCTCTCCATCCAAATTTTTCGTTTCGACGTAGCAGACACCGGTGTTACCTCCGCTTCGTGCACCTTCAGCAGGCACGACGGAAAGAATGAGAACGTCAG
CAGGTAGCGTCTCATGGTTCTTGATCTTGACAAAGTCGCCGACTTTGACATCGCGCCA