Description :
From Genome Similarity Track
Location :
contig_68:18667- 22739
Transcript NameFunction/comments
g11879.t1hypothetical protein

Sequence
4072 bases(100 bases per row)
ATACATCCCACTCCTCCAAAACTGCAGCCTTCCTGCAGTTCCTTCTTCAATTTCCCGCCGGCGTGGCCAACCCACACCAACGGGTCCCGCCTCACTATCG
TTCGTGAGACTGCATCACACCAAATCGGTTGTGATTCGCGCGATCCCGTAGGAACTCATGCAACAACGCACCACAGTTGAGATCCGCTTCATCGATCCAG
CTGGGCTCCTCATATCCACGCCAGTGTACTAGAATTCACGATAGATCCGTCCATATCTCGTACGTTGCCGGACTCAGATCCGTGATCTTCTCGACTTCGT
ATTCATCGGATCCAGATCCGAGATCCAACTATCTTCCGGTAATAGCGCTTCATCGAAATCTAGCCGATCTACATTGTCCGCAACCAGCTGAACGAGCGGG
CGATCTGGGAATCCTTCACCAACTTCAATTTCGATACATGTACCACCGGGAACAAACGGTAATCCGTTCCGGCAGTTTCGAGCTTGACCGCGTACTCATG
GATTTTCTCTGCCACTCGAAATGGCCGTGCCACAAGTGCGCCAACTTACGGGCGTAACCTTCTTTCACGCGATCCAGGTATAGCCAGACGCGAGATCCAG
CTTCTATCGGGTGGGGTCGGACGTCGTCATTGTGCGAATCTGCTCGATCTGCGATCGCCTCACGGAGCTTTTCGTTGACTTGTTCTCGGACCCGCGTAAT
AACGCTGGATCCGGTAGCGCCATCGGCGTGGATCACGATCTTGACGTCGGTACTACCCACCGGGATCGTGGCCTCTAATGTAGATCTAGGATCCCACCCA
TGTACCAAATAGAAAGGCGTATCACCTCGGATCCGATCTTGGGCTGTGTTAAGGGCAAACGTAAGCCGCTCGGCGTACTCGTCCCAATCCTGTTGATCCA
GATCCTGGACATGCATCTTGAGTGCGCGCGTGATCGTTTGAACCATGCGCTCCGCCGTCCCATTCGCTTGCGGTCGGTAAGCCATAGTGGCCCTCTGACG
CTGTCCTAGGATCTTGTTGAACGCTCGGAAGAAGTCGGACATAAATCCTGGTCCCGATCGTGCCGAATTACCTCGCTTGCGCCAAATCGGCGGAACACAC
ATTCTTCGTAGGATTCCGCTATCGTTTGAGCCGTCCTGGATGAGCTGGCCTTGGCCATCACATAGCCAGTGAACAGATCAACCCAGATCAGCAACTCCGT
GTTGCCTCTATGCGATTTCGGCAGCGAAGGTATGTGATCCATGGCTATGATCTGGAACGGATAGGTGCTGGATATTCCCTGGCGACTCGCCTCGGATAGT
TGGCCGACCTTTTCCGGTCTCGCAGTCTACACATTCCCCAACATACCGTTGGACACTCCGGTACAGGCCTCTCCAGTGGAAGTGATCTCGGATCCGCTGG
TAAGTGCGGCCGATCCCTTGGTGGCCTCCCTCTACACTAGCATGGTAGTGGTGCAGGATATCCTGATGGAGGGTTTCGGGTGCAACCAACCGCATCGCGA
GATCTCGATCTTCGTCAGACTTCCGGTTTGGTGGACAGTAGAAGAGTAATCCGTCCAGATCCATCTCGTAATCCATTGCCAGATTGCTGTAGGATCGAGC
TTCTTCCTGGGCCAACGTAGCTACATCGCCACCAGATACTTCTTCATTCCGGCGATCCATGACTCTTCATCTTGGGCCCGACGAATTCGCTCTATCCTGA
GCTCCCTCACCAATTCTTCCTGCATTACCTTCGGACTAGATCCGGATCTGACTCCAGATCGGGTGATCACCGGCGAAACCGGACCACGGATTCTTGGACT
GTACGGTTAGAATCTCGTCCAACCGGTTTAGGGTCACCAAATCCGGATAGTCTTCCTCGTCCACTAGGATCCCGCTGTCGCTGAAGGGCAGCTCCGGCGA
GGCTGTCAGCGGAACCATTCCAGTCTCGCTTAACATGTAGCAGTTCGTGATCTGGCCACTCTCGCACTCGATCTAGAGCTTTCTGTTTCAACAGAACCAA
ACCTGGGGCCTTACAATCAATTTCTCCTCTCACTTGCCGGATCACCAAGTTGGAATCCCCGCAGATCACTAGACGTCCACGCTCCACTTCAGCCAGGAGG
TCGAAACACAACAAGAGACCATTATACTCCGCTTCATTCACCGTCATCCCTTCTGCATAACCCGATCGGGCTTTCAGCACGGTCCATTCTGGTAGTTTCC
ACAGGATCGCGCTGTACGCGCCTCCTCCTCGTTTTACTCGGGCCGATCCGTCAAAGCTTACCACGTACAATTCTTCATCAGCCTTCACCGTGGGTACAGG
AGCTTGGATCTGCCGTCGGGGTCTTTCTTAGGCGCGATCGCGATCAACGCCTCTTCCACATCGGACCTAGGTGTAATACTGGCAGCCATCGCCCCTAGGA
TTTCGTCTTCACCTTTGGTGCACTTCATAATTTCAAGTGTCCATGGCGACAGAAGAGCTGCCCATTGACCCAGACGTCCCTGTAGCCCCGGCGATCGGAA
CAACCATGCTAACGTCGAATGTCGAGTTAGGATCCGGATCTCACGTCCTACCAGAAGGTTGTAATTCAGATCCAAGATCCGTAGCAACGCCAACACTTCC
TTCTCGACCACATTATAATTCAGCTCGTTCGACTTCAGTGTCCGACTGGCGAAAGTGACCGGATAGTAGATCTGATCGTGACTCTGCATCAAGGCGGCGG
AAATAGCCCATTCGCTAGCGAAGACAACTACTACTGGGAGTAAATCGGGATCGAAGTGGCGCAGAATTGGAGCGGTGGCGATCTTGTCCTTCAACGCTGC
AAACGACCTATATGCTCTGACCACTCTCGTCAGCTGCATCTACACCTGACATTACCGGGGTTGCAGTAGTTGAGTGGGAGATCTCGGGATCGGGTTCAGA
CGAACTGTGATCCAGGATCCGACGAAGATCTGGGCGCTTCTTCAACTCAGCGAACTCCACTTCGCGTAATTCATATAGAACGGCAGCATAGATCGCATAG
TCCTCGATAAATCGGCTGTAATAGTTCAGGCTGCCCAAAAACGACTGCATGGATCTGAGTGATCCCGGAAAAGGTAGATCCGTCAAAGTCTTCAAGTCCT
TCGGATTAGCTTCGATGCCATCGTCGGACACTCGGTGTCCCAGTATTCCACCCGGGGAAGACCCCAGAAACTCTTCACCACACTTATAGACAGGTTCCAT
TTATCACACGCTTCGAGCAGATTCTCCACTCGGTGGCACAGTTGATCCCAAGATCCAGCTGTTACCAGATGTCATCGATGTAGGATCTGCGTCCTAACAC
TGACGGACGACCTGGATCTTCCGGTTCTCCAGCCTCAAAAAGATCTGGAGCAAGTCCTGGCTCGTCAGTAGGCGGATCCGTGTAAACCCATATAACGCAT
TATCCAGAAGCCGCTGATAGATCTGAGGCGCATTCTTGAGTCCGAAAGGCATCCGGTTCCACTCGAACAAGCCGAATGGAGTTATGAAAGCCGAGATCGC
GCGAGCTCGGTCCGTCATCGACACGACCCAAAATCCGCTTGCCATGTCCAGCGAACAGTACCATAACACCTTGTTCAGATCCTCTAATAGATCATTGATC
AGAGGCATGGGGTAGATCATTAGTCGAGTGAGACCATTCACCAGTCGGTAGTCTATACACAGCCTGATGTCGATCCCGTTCTTTTTGATGATCACCACGA
TCGGTGATGCCCACGGCGATGTCGAATGTCGAATCATCTTTGCTGACAGCAACCCCTTGATCAGATCTGACACCTTCTCCCGGAACTGCGGTGTTATTTT
CCGCACCCGTTGCACGATCGGCTTTGCTCCCCCTACATCGATATCACACACGACTCCTCGGGCAGCTGGCGGTAAGGCATTACCTTTGCCTATCAACATG
TGTCGTTTCCGCCAGATGATCTGCCGCAGACGATCGATCTCATCTGGAGTGCTGCGATCTGGATCACCCACCTGGATATCGTCAATAGTCACTTCCCTCG
TAATAGCCGTGATCTCTGGCAATACTGCCATCTCGCCTTCCACATCTTCAGCTAGCAGATCACCAGCTTCGT