Description :
From Genome Similarity Track
Location :
Scaffold_4:1866468- 1873810
Transcript NameFunction/comments
Phyin_T30-4PITG_03463Carbohydrate esterase%2C putative
Phyin_T30-4PITG_03464Aldehyde dehydrogenase%2C putative
Phyin_T30-4PITG_03465Glycoside hydrolase%2C putative
Phyin_T30-4PITG_03466Aldehyde dehydrogenase%2C putative

Sequence
7342 bases(100 bases per row)
CCCTAGCGAGGTGTAGGACGCAGAAACTATTGGTGATTTCCTCGTAGGTGTTGGGAAGGACAGTAGAGAAAGCATGATCTAACACACAAATATGTAGCCC
GCGTTACATTAGTCGGCAGCGTTGGCAATACTTCAGCACTACTACATGTACTTCTACATGTACTTCTACTGTTGTACTATGTGTAGTAGAAGTAGCTCTT
CGAAGTTCACAATAAAAGGGATCATGCCAAATCGATTGATTTCTTGTCTGAAATTTGTTCACCACTGCAGTCATCTATCCACCTGCAGAGCAACCTTCGT
TTTCTGTAAACTCTAAACACGGAAGTTCCACTACACACCAACCAAGCACAGCGTTAGTAGAGAAATGAGAGCAAGTAATGAACACTAGCACTTACCGCTT
TGAGCTTCGTGACGCCACGGAATCCGTGCTTTGAGAGGCTGACGCCCTTGCCGGAGTCACGGTTGCCAGTCCACGGGAGATAGGGGTCAAGCACGTCGCA
TCGATTCATGTACACCGTTCCAGCGCTAATCTGCGAGCCCAGAGCCATAGCGTGCTCACGGTCTGATGAGAATACCGACGCTGTCAGTCCGTACTTGCTG
TCGTTGATTTTCTTGATGGCTTCAGCATCCGATGACACACGTTCAACACCGACAATCGGTCCGAAGGATTCCTCCGTCATGATGCCCATGGAGTCATTAC
AGTTCGCAAGCAGGGTAGGCGAGTAGAAGCGGCCTTTTCCAGCTGCGTCCGAGATTCCGCTTCCCGTCAGCTGTAGAGCACCCTTCGCCACTGCGTCCTT
CACATGAGCATCGAGCATTTCCGGAGCAGTAGGAAGTGCCATCGGACCCATCGAAGTGTTGGCGTCCGTCGGGTCACCCAAGTTGTAGGCCTCAAACAAA
CTCTTCGCCTTCTCCAAGAATTGGTCGTACTTGGACTCGTGGACGTAGATCCGCTCCACACCGCAGCACGACTGACCGGCATTGTAGCAAACACCATCCA
CAAGGCCCTCTGCTGCGGCTTCAGCGTCAGCTTCAGCAGTCACGTATCCAGCGTCCTACAACAAGGTAGTAGGTATTAGCGCTCGAGACTCAAAAGCAAA
GAAGCGGTAGCTGGCCTACATTTCCGCCCAGCTCCAAAGTCACATCGATGGAGCGTTGGGATGCTACTTGTTGTACTTGTCGTCCGCTGTGGTGGGGGAT
CCATACTATTAGAAAGCGGGCCCACAAGTTGAAAAACACGACAGACGTACCCTCGGACAGACCCCGTAAACGATACGAATGCCGTCTCCGGGCGCTGGAT
GATCTCTGAAGCCGTGTCGTGCTCAACAAATGACGACTGGAGCACGTTCTTCGGGAAGCCCGCTTGCTCGAACGTCTTTTGATAGTGCTCTCCGCATAGA
GGAGTGCGAGGCGAGTGCTTTAGCAGCACCGAGTTACCGGCCAAAACAGCGGGGATGATCGAGTTGACTGCTGTCATGAGAGGATAGTTCCATGGAGCCT
GTTTCCAGTTGCAGAGCATTAGGTGCGACTAGTGAAAGAGAAGGAGTTCAAACCACGTACAATAACATAAACGACGCCGACAGGATCGTGCGTGATCTGG
CGGAACAGTCCATTCTCTTCCGGGAATGAATCTGTGCGGAGGGCCTCGTTGGAGAGGTAGATGAGAGCCCTATGCAGCAAATAAGCAAGGTTAGAATTGC
CCCAAAACTGAGCTTATGGCACATCGTACTTGGCACGGTCAATGGTACCGTTGACCTCGTTGCGAGCTTGTTGCACAGGCTTCCCCATCATGCCAGAGAT
CTCATGTGCAATGGATTCGGAGTTGCTCTTGAGGGCGGCAATCCACTTGGTGCACAGCGCCTGACGCTCCCTGAGTGGCACGTTCTTCCAATCGAGCTGA
GCCTTCACTGCCGCATCGAGCTTGGCGTGCGCCTCAGCCTTCGAGTCATAATCGACCTCGCAGAAGGTCTCGCCCGTGTATGGATTGTCCACTTTCAGTC
TGCAACAGCAGCGAGCAATATTTTCAACTATGGAGTGTCTTCGATGTAGCGGGCAATTGCTCTTTTAACGTACGAGGAAGCAGCGAAGCCGCGCTGGGAA
GAGACCTTGGCGACTTGACGAGCGGTTGTTGCGAGCTACAGTAGCAGCAGTGAGTTCACTGGCAGGAACCTCGCGGACTCAAAGTTGCCAGGGATACCTG
AGTGGTGTGGCGAAACATTTCGGATTGAGGAGCTGTTGGTGAATGGCAAAGTGATCTGCAACGTCATCTGTTTCGATTAGATCCCTTGGCTAGCGCCACC
AAACGCTTTTGATTCGCTGATAATTCAACCGCCCACTCCCGTCGCATCCCCTCAAGGTAAGGACGCGATGGCGTGTCGCCGCGTTCGACTGCTCCGCCGA
TCTCCACTCACCAACAAGATGCTCAGGCGCGTGGCTGCTCGCTCGCCGCTGCATGCGTCTAAACTTAAGCTCCTGCACACGAGTGCGGCTGCGACTCCTG
ATGATCAAGACGGCATCCGATACCTGGTGATTGACGGCTATGTGAAAACGGGCCGAGATGTGCTGGAGGCTGGTGGTGCCACCACCGCTGGCCAGTTGTA
CGCCAACATGCTTGTCAAGGCCACAAAGCGCAGCGTCGATCGCTCCGCATCGTACGACCTTATCTATCGCCGCATTCGCCCTTGTACACCACGAACTCGT
CGGCTCCCAGGCCGCGCACCTCCTGCTCCTTTTAGTTGGAGCGCGAGAACGCCGTCACGGAGGCGGCACCCATAGCCTTGGCGAACTGGATGGCAATGTG
GCACAGGCCGCCAATGCCCACGATGTCGACACGGTCACCCTCCTTGATACCGGCTTCCTTAAACGGCGTGAACACCGTCGTGCCGGCACACATCAGAGGA
GCAGCCACGTCCGACGGAATGTTATCCGGGATCTTGATCGCAAACTCGTGCGGCACACGGAGCCTCGGGGTCCTTGTTCAGACACGCCGACACCAGCGCT
CCGACACCCACACGGTCGCCGACCTGCAGGCCCTTGATGTCGGGACCAGCCTGCGTAACTTCGCCGACGATCTCGTGTCCCACCACGCACGGATACGTGG
TCTGTCCCCAGCCGCTGTCAAGCGTGTGCAGGTCTGAGCCGCAGATGCCGCAGTGCGAGATCTTGATCTCGACGTCTTCGGCGCCGAGCGGGCGAGACTG
GTACTCCCAGGATTTGATTTGCCGAAGGAAGCTCTTGCTTGGCGATGCGTAGCTCCTTAAATCGCTCCTAAATCGAATTCTAAAGTCAAATGTTGACTTT
AGAATTCGATTTTCCAGAGCAAATATTTCCAGCTGGTCACAAATTAGAAGCGCGTTATTTTCTTAATAACCGGTATAAGAAACAAATTTACTACGTGTAT
TACTTTAAGTTCAGATCTATACTTCAACCCCAGCTAAGCGTAAACGTACAGCATTTTGGTCTTGTAAGGCCGGAAGCAAAATCTCCGGCGCTACCAACGC
GGCTACAATCTCGTTCCTATATATTAACTCGGTGTTCGTTCGAGGAATTATATCCTGCAGATATGCCTCGAATCTCTCTCTCTCTCTTGCAAGTTGAAGT
CGAAGACCCTCAGTTCGGCGTTCCTGTCTTGCTCGCAGCTGCTGTATCTGACGGGCACATTGTTCTGGCGACGCACGATCGCGTAGCAAGCGACGATGAA
GCGCTCGCACTGCAGCCCGGTGCGAGCTTCGACAGTGCTCTGTAACAGCACGCTGACGGCGTCTACACTCGGTCATCTCATCTTGAATCTCACGCTGGCG
CCGTCTGTCTTCGCGAGCAACTACATTCCGCGCGGATCGACGACCGCGATTTGCATCGTCTCTCATCAATGTGAAGACTTCCTGCACATTTAGTGAATCT
CTTGTGAATGTGACGTATTCAAAAGACTCACTGTGACGACATCGGTCTCGAGCGTATCTCGTCATACCGCGGGCGTGATAACGCATGCGAAAACGTCGGA
GTCTGTTGCGCATTGCATTCTCCACGTCATGAAGGAAGTTTGTCTCAGGAAGCAAACCCGTAAGTGCATGGCGTAAAATAAGTCTTAGCTGGTCTGGCGG
GTAATTTTTGCCGATCACGAGCTCATTTGGTAGATACGATCCTCGATCTCCAATCGAAGTACTAGTAAATCCATATTTACAGACGAAATGGCCTCGATTT
CAGATATGGGATGTTGAAATAGCCAGTAGTGGAATTTGGGTGCAAATTGTGATGTTCATCCTCGTCGGTCATTGGTGACAGCTCAAACATATACTCGCCC
GCCTCATCATAAACGGGATGTGGGTCTCCAAGCAGCTACTGTACTCAATAGGTATTTCGAGATACTGCCGTGCAAGTCGGTCTTGATCCTCCATCATCTG
CGCTTTTCGTTGCAAATTGGAGAATGAAATTAATACATGTATGCATGATTCCTCGTGCTAATATGTCTCCAGGTCGATAAATATGTCTGAGCGAAAATTT
CATAAGACAATACCGACACTGAATTGATCGCCACACTCGTTTCGCGTCTCTCTAGAAGAAACCTCGAATGTCACCAGGTCGATAAATATCAGCCAGCAGC
CTTGAAATTGTTTGTATGATTCTTCGACTGTAGCATTTGTATGTGCTCTAGAGTCGGCAACCTAAAATACGTATGTACCAAAATATATAACTAGTCTGGA
CTTGGAAACTCTCGGACCAGAGGACGTTTGGGATCTTACCATGAATATCAATGTAAAGGGCGTCTTTCTCGGCTGCAAGTATGGCATCCCGGCCATGCGT
CGTGCCGGTGGCGGCTCCGTCATCAACACGGCCTCGTTCGTGGGCATCCTAGGCGCAGCCACGCCCCAGCTCGCCTACACATCCAGCAAGGGCGCTGTCA
TTGCCATGTCTCGAGAGCTGGCCACGATCCACGCTCGCGAGAACATCCGCGTGAATGCCCTATGTCCCGGTCCGCTCAACACCGAGCTGTTGCAGAAGTT
CCTGGACTCGGAGGAGAAGAAGCAACGCCGTTTGGTGCATGTTCCTATGGGTCGTTTCGGAGAGGCTGCAGAGATGGCCAAGGCTGCACTCTTCCTTGCT
AGCGATGATGCGTCGTACATTACTGGCACCTCCTTCGTTGTTGACGGCGGTATTACGTCTGCCTACGTGACGAGCGAGGGTCGTGTCGACCCTTTCGGAG
GCCCTAGCGAGGTGTAGGACGCAGAAACTATTGGTGATTTCCTCGTAGGTGTTGGGAAGGACAGTAGAGAAAGCATGATCTAACACACAAATATGTAGCC
CGCGTTACATTAGTCGGCAGCGTTGGCAATACTTCAGCACTACTACATGTACTTCTACATGTACTTCTACTGTTGTACTATGTGTAGTAGAAGTAGCTCT
TCGAAGTTCACAATAAAAGGGATCATGCCAAATCGATTGATTTCTTGTCTGAAATTTGTTCACCACTGCAGTCATCTATCCACCTGCAGAGCAACCTTCG
TTTTCTGTAAACTCTAAACACGGAAGTTCCACTACACACCAACCAAGCACAGCGTTAGTAGAGAAATGAGAGCAAGTAATGAACACTAGCACTTACCGCT
TTGAGCTTCGTGACGCCACGGAATCCGTGCTTTGAGAGGCTGACGCCCTTGCCGGAGTCACGGTTGCCAGTCCACGGGAGATAGGGGTCAAGCACGTCGC
ATCGATTCATGTACACCGTTCCAGCGCTAATCTGCGAGCCCAGAGCCATAGCGTGCTCACGGTCTGATGAGAATACCGACGCTGTCAGTCCGTACTTGCT
GTCGTTGATTTTCTTGATGGCTTCAGCATCCGATGACACACGTTCAACACCGACAATCGGTCCGAAGGATTCCTCCGTCATGATGCCCATGGAGTCATTA
CAGTTCGCAAGCAGGGTAGGCGAGTAGAAGCGGCCTTTTCCAGCTGCGTCCGAGATTCCGCTTCCCGTCAGCTGTAGAGCACCCTTCGCCACTGCGTCAT
TCACATGAGCATCGAGCATTTCCGGAGCAGTAGGAAGTGCCATCGGACCCATCGAAGTGTTGGCGTCCGTCGGGTCACCCAAGTTGTAGGCCTCAAACAA
ACTCTTCGCCTTCTCCAAGAATTGGTCGTACTTGGACTCGTGGACGTAGATCCGCTCCACACCGCAGCACGACTGACCGGCATTGTAGCAAACACCATCC
ACAAGGCCCTCTGCTGCGGCTTCAGCGTCAGCTTCAGCAGTCACGTATCCAGCGTCCTACAACAAGGTAGTAGGTATTAGCGCTCGAGACTCAAAAGCAA
AGAAGAGGTAGCTGGCCTACATTTCCGCCCAGCTCCAAAGTCACATCGATGGAGCGTTGGGATGCTACTTGTTGTACTTGTCGTCCGCTGTGGTGGGGGA
TTCATACTATTAGAAAGCGGGCCCACAAGTTGGAAAACACGACAGACGTACCCTCGGACAGACCCCGTAAACGATACGAATGCCGTCTCCGGGCGCTGGA
TGATCTCTGAAGCCGTGTCGTGCTCAACAAATGACGACTGGAGCACGTTCTTCGGGAAGCCCGCTTGCTCGAACGTCTTTTGATAGTGCTCTCCGCATAG
AGGAGTGCGAGGCGAGTGCTTTAGCAGCACCGAGTTACCGGCCAAAACAGCGGGGATGATCGAGTTGACTGCTGTCATGAGAGGATAGTTCCATGGAGCC
TGTTTCCAGTTGCAGAGCATTAGGTGCGACTAGTGAAAGAGAAGGAGTTCAAACCACGTACAATAACATAAACGACGCCGACAGGATCGTGCGTGATCTG
GCGGAACAGTCCATTCTCTTCCGGGAATGAATCTGTGCGGAGGGCCTCGTTGGAGAGGTAGATGAGAGCCCTATGCAGCAAATAAGCAAGGTTAGAATTG
CCCCAAAACTGAGCTTATGGCACATCGTACTTGGCACGGTCAATGGTACCGTTGACCTCGTTGCGAGCTTGTTGCACAGGCTTCCCCATCATGCCAGAGA
TCTCATGTGCAATGGATTCGGAGTTGCTCTTGAGGGCGGCAATCCACTTGGTGCACAGCGCCTGACGCTCCCTGAGTGGCACGTTCTTCCAATCGAGCTG
AGCCTTCACTGCCGCATCGAGCTTGGCGTGCGCCTCAGCCTTCGAGTCATAAGCGACCTCGCAGAAGGTCTCGCCCGTGTATGGATTGTCCACTTTCAGT
CTGCAACAGCAGCGAGCAATATTTTCAACTATGGAGTGTCTTCGATGTAGCGGGCAATTGCTCTTTTAACGTACGAGGAAGCAGCGAAGCCGCGCTGGGA
AGAGACCTTAGCGACTTGACGAGCGGTTGTTGCGAGCTACAG