Description :
From Genome Similarity Track
Location :
Scaffold_305:18650- 21764
Transcript NameFunction/comments
Hyaar_Emoy2813655DNA mismatch repair protein Msh2, putative
Hyaar_Emoy2813656hypothetical protein

Sequence
3114 bases(100 bases per row)
GAAGCCTTCAAGCTCCTGGCTTTTCCTCCGAGCGCATTGGATAACAGAAGAGGGGAAACCCGCCATCGATGCTACATGGACACCAAAGCTTTCCATGCAT
GGGCCGTCACGCACCTGGTAGATCATTGTGATATCCCTGTCGCTGGCTACAGCCGTTACGTGCTTATTTTTAAAGCCGCAAGGGTGCTCGTGCTCCAGAG
CTGTGAGCTCGTGGAAATGCGTTGCAAAGAGACACATGGACCGCGCTTTGGTGAGGAGGTACTCGGAGATAGCCCATGCCAACCCAAAGCCATCGTACGT
CGAAGTGCCTCGACCCAGTTCGTCAATAATCACGAGCGAGTGTTTGGTGGCTTTGTGTAGAATGGCCGATGCCTCCAGCATCTCAAGCATGAACGTAGAC
ACTCCCCGCTGCTGCAAGTCACCTGCACCGACACGAACCAGCAACTTGTCGAACAAGGGCAATCGGGCGACTTCGGCTGGTACGAAGCTACCGATTTGAG
CCATCACAGCAATGGTTCCCAATTGGCGAATGTAGGTGCTCTTACCTCCCATGTTAGGCCCCGTGACGAGCTGGAAGCGCGATGTCTCACGATCGAATGT
GTAATCATTTGGGATAAAGTCCACGCCGTCTTGCAGTTCCACGCAAGGATGGCGTGCGCTAGTGAGCACGATACTGTCACCATTAGGATCCAGGATGGGA
CGGCAATATCCCGAGCCAGAATGGCACGCAGCGTGCGCAAATCCAAGCAGCACATCTAGTTCTGCGAGTATCGCAGTTGCTGCTTCAAGCACCGGCACAT
ACGTGCTGGCAACGTCGATCGCAGCATTCAGCAAATGGCTCTGCCGTTCCTCGTATTCAGCGCACACACGGCGGTAGTCGTCGGCAAGAGCTTTCAACTT
TGTCGTCGTGAATTGGACTCCACTCACAAGAACTTGGCAGATGTGCACGTGCGGCAGCTTGGACAAACGGGCTTCCTCCTTTTTGTTAACAACACGAAAA
GCAAACCCACGAACTTTGTCTTTCTCGCACTTGATCTCGCCACCAATGTCGTCCAGTGCGTCTCGGTGCTCTTCTTCAATGTCTGCAAGGACGCTGTCCC
ACTCTTCACGCAACGCCTGCAGATTTTCATCGTGCTTGGCATTCACCACGAGAGTTGGACGACTGTCCAGGTCGATCACCTCCTCGACGAGCTCCGTGTA
GCCTTGCAGATCTGCTAGCACCTTGTCCAGCGGCGCAACGAACGCTTGCTTCATAAGGTCTGCGATCGTGTCATCGCCACCCCGACTGACATTTGTGCTC
TTCAAAGACTGCAACACACGAGGCATGGCACCAACCGCTGCGTCGTACACGCTCACGAGGTCAGTGATCTTCGCATTTTTTTTCTTTTCCAGACAGGTGG
CCAGTCGACCCAAGTCAGGCAGCGCCTTCATCCCTTCATCCAGCAGCTCCATCCTGAGCGACGAGTCGTTCACAAACAGTTGCACAAACCTCTGCCTCTT
GTCAATCTGCTCGACATCAACTAGCGGTTGTCGGATCCAGCGCTCGAGCAAGCGTCGACCCATCGCTGTCTTCCCTCGATCCAGAATCTCCAAGACACTG
CCTCCGAACCTCCCTCCTCCTGTCATTGTAGAGCTTAGCTCCGGCAGCAGATTCAGCGACCGCAACGCAGCATTATCAAGCTGCATGGCCGATAAGAGAC
TCCCTTCTTGCAACGTGTAGCAGCCAAAGGCGTCCGCGTCGGTCACGACACCCAGCGCGTCGAGCAAACAGGCCAGCGAACCGGCAGCTAGCTTGCAGGC
CAGCATCTCGGGCAGCACAGCCATTGTATCGGCTCCAAGGAGTCTTGAAACGTGCTTCTCGACGCTACTCACGTCCAGGAACAAGTGCTTCTTCACGTAA
ACTCGTGCCACGTTATGGGTCTGGAGGAGCGCGTGCAGCTTCTTGCTGTCGCCCACGCTCTGCAGTTGCTCGACCTCTGCCGACAGGTAGCACGTGGAAG
GTGCAAGTTGCACTAGTAGGGACTCGAGCGCGCCCAGTTCGCTTGAGTCAGCGATCGAGAAGAGCAGCAGCTCCCACTGCTTGGTATCTTCATTGGCTTG
GCCCTTGATACAGGACGAGCGCGAGCGAGGACGCCGCACGGCAACGCCGACTTGCTTCAGGTGCTTGTTGTTACGTATCTGTAGCGCCATCTCGGTCTCA
TGCGCGTCCTCCATTGCGAACAACAGCAACAATAACAGCAAAGACAGCGACGATCCTCTGCGCTTGCAGGCGTGGACGGTTGATATGGCAAGAGTGATGG
TCAGGAGTGATGGTCGGTCAAGAGTGAAGGTCGATGGCGCGTGCTGTTCCCGCGCTTTTTTGTGGCCGGCCAAAAGTGCCCGTTGTGGATATAGATAGAG
GGGATTTAGACTGACCGTACCGTGTTTGCGACTCTCGTTGACCGAACACGAAAGACGAAGGTTGCCATTTACTATGCCATGATGACCGACTGGCAAGTCG
AGTATCTCAAGGCCGTGGCCGTCGAGGACGAGCGCCCGTCGTCTGTGCAGACAAATGAGACGTCAACAGGTAGCGTTCTGGAGTTCTTGAACTTGATTCT
CGCGCAGGAAGGTGGCGAGTGGTGGACGAAGCTCCAGCGTCGAGTTCAACGTGGTCGACAGACCAGGAATGTTGGTCAGTGGACGACTCCAGCGCTGCAT
CCAACAGACGAGACCGAGCTTAAGACGTTGAAGAAGCGACTGGCTGCAATAGGGGCCACGTTGCTCGTGCCGCTGCCTGAGCTGGAGATATCGATCAGCC
GACACGAGCCGCTGCGTCCCGCTAAAGTGCGAGTGCTGCAATTGCAGCTCGTGTGTCGCATACTGCGCTATGGCGCGTTAACAGGCAGGAAAGAAAAAGA
GGAAAAGAAGCTGTTGAAGAAAGAGATGCGGAGGCTGCTGGATCGGGTGGCGCTGCTGCTGGACGCGGCCAATCCGCCGTCGTTGATGGACGACGGCGCC
GAGGAACGCTCGCCGTTTCACGAGTTTCTCGAGCATCAATTGGGGGCCAGCCTGATGGTTTTAATGCCTGAGTTGATGCGGTATTTGCTCAAGGTTTACG
AACTGGAGGATGAG