Description :
From Genome Similarity Track
Location :
Scaffold_1561:1865- 5135
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1561-snap-gene-0.1Telomerase reverse transcriptase

Sequence
3270 bases(100 bases per row)
GAACCAGTCGATGGAATTGGGGTAAACCAACTAGGAGTTTCGAGAAAGCGACCACGAAAAAGGGAAAAGGTCTCTTTTGCGTCCAGTTACGAAGTCTCAA
CAAACCTATCGAAGCTGCAAGAGCATCGAGACGAAATCTCACGGCTAGGAGAATGTGTGGTATCCAAACAAGTCGTGTATCGGTTGGTTCGAAAGTTTGT
TGCTCGCATTATTCCAAAGGAGTTATGGGGGCCTCATACTGGATCTGAAAAGAACTGGAAACGTGTCAAGCAGCTTCTGCGGCACTTTATAGACTCCCGG
AAGTACGACATCATATCGCTAAAAGTGGTAAGTGATGATCGAATATTTTTGCAAACGTTATGCCAAGATGGTGATGCTAATCAAACTCATTCCCGTTTAC
CTCAAAAGTGCTGTAGTGAACTGCAAGTAAAGAATGTCAAGTGGATGAATACCCAGGGAGACCCGTCTTGCTGGTCTGGACTAAAAAAATCTATTTCGCT
CATGATCAAAACTGGTCGTAAATGCATGAAACTCACTCGTTTCACTGGGTTAATTTGTGTTTGTAGCCCTCCGAATGAACTCGTCAAGCGTCAGAAGCTC
TTCCAAGACGTGCTCTCGTGGATTCTGAGAATGATCGTCTTCCCACTGTTGAGAAATCTGTTTTACATCACAGAGCGTGAAGGAGGATCCAACGAGATCG
TGTACTATCAGCGAGAAGTGTGGAGCGCCATCAGGTATGTGAGTCTTTGCATTACGGTCGCGACGACTAAGGAAATGCTCTTGCTAAATCTTGCTTTGCT
TGTTTGCAGCAATGCGGCAGTTTACGATCTGAGTGCTGCAGTGCTCCATCCCGTCAGAGAAGCATGTTCTTACGAAAACGCGCGACAACTAGCAACCTCA
CGATTGCGTTTACTCCCAAAAGTGAATGGAATTCGCCCATTGATGAATCTGTCGACATCGGTTGATCATACGCAGATATCAGTGAACAAGTCGCTCGAGG
CAGTGCATCGAGTGCTACTCTTTGAAGCTGACCGTCAATCGAAGCATCTGCTTGGGGCATCCGTGAGAAGCATGGATGAGATTTACCAACGCATTAAGCC
TCTTTTCCAAGCGATTTCATCCTGCGGCAGTTGCACGGAGCGTCGGAACGCAAATGGTGGTGGTATACCTGCTGTTTATTGTGTATCCGTGGATATCGAA
CGGTGCTTTGACACCATTCGTCCTCGGAAGCTGTACCGAATTTTGAAGAAAGCGATTTTGGAAGACGAGTACTTAATACGAAAGCACTGGGTGTATCGTC
GAAGCAATCTTGCCAATATGGGGAAGAATCGCAAAAGGACGTCGCCGATCATATTTAAGATGGAGCGTCGGGCATTTCGATCAGGAGATTTGTGCGGATT
TGACGAGCTCGTTGCGAAGTCAAAGAAACGGAACGCAGTGTTCCTCGATGGAGTTCTGTACGACTATCTCCCAAAGTCCAAGATTCTAAGTTTGCTGAAA
GAGCATCTTCTACACAACGTCGTTCAAATAGATGGTCAAGACTTTATCCAGCAACAGGGCATTCCGCAAGGATCAGTGCTGTCGACATTGCTTTGCAATC
TCTATTATGGGCACTTTGAGCGCAAGGTGCTATGGAGACGACTTGGGAAGTCGTGCGTGCCTGTAGCTGCAAAATGCTGCCATCACGAAGACCTGCTGAG
ATACACGGATGATTCTTTACTCATCACGACGAATCTGAAACGTGCGCAGACGTTCGCGAAGATCATGCACGAAGGCAATAACGAGTATGGCTGCTACGTC
AATTTTGCAAAGAGCCGCGTCAATTTTGATGTTTCTGTTGCCGAGGAGCGAGGGAATTGCCAATCGATCCCAAGATTCGACCAAGAAGAGTCTGACGGCC
GATTCAGTTGGTGCGGCATGTTGATCGACTCAATTACACTTCAGATCTCCGTCAATTACGAAAAGTAAGCTACTGCTGGCTGTCTGAACATGCCCTAAAC
TATGACTTTGTCTATTAACCCTCTCTAACTTTGTGTGAGTGATCAATAGTTCACTGGCCCAACCGTCGATCCCGTTGGACGAGACTAAAGCGCTTGAGGA
CTTCTTTGTGAACAAGGTGCTTTCGTCAATTCGTCAGCGATGGCATCCACTCTATTTCGATCCATCACTTCTATCACGGTCAACCATCCAAGTAAGCATG
GCAAAGTCGTTTGATTGTGTTGGATGGTTCATTTGTGCTAACTTTGATTTTTTTTTAACACAGGTGAATTTATTTCAGATGCTGTGCGTCGCCGCTGTGC
GCTTTGCTGTGATTGTTGACATGTTGCCGTTCGTCAATCGAAGCGTGAAATTCCTTCACCGCAGTGTCCACCAAATTCTCGCAATGACGACAAAAGGTAT
TAATCGGTGTGTTGCGAATGTCACTACTACTGCAGCCGCCTTCAAGAACGGAAACTTGTCAAAGCTGACGAAAGAGGGAGTACCCAATGCCGTCACCAGT
GGAGAAGACTCGCTCAAACACAAAAAAGCGCAATGTGCAGTGGAGAAATACGAGGTGGGTGTACTCCAAACGTTTGGGTTGACAACATAAACATGCCATT
AATGTGTGGTGCCTATTTTGCGCTTGCAGGTCTGGAGCATTGGTCTACGCAGCTTTCAGCTAATCCTGCAGCAGCAGTTACGTCAGCACGACAACGGCAC
AGCAAGAACGAAGCGTCAATCGAAAAGTAAACTGGACATCGCCTCACACTGGACGCTGCTGCTCGATTTGCTGCAGCAGGACGCTTTGCGACGGCAACCT
CATGGCCCAGCATCACCATCAAACTCTGCACGTGGAGACGGAGAGGATCCGTTACAGTGGCTTGTTCAAGATACACGGAACGCGTTCATCATAAGCCAGC
TTCTGAGGACGCCATTGCCGTCTCCAGAATGATTTGCATCGAGACTCCTGTACAGAGCTGCAAAGTGATAGTTGCAGCAGATCGTGGCGCGTCCATACAG
TTTACAGAAAGTATCAGAAGTGGGGCCGTTGCAGCAACGGTTGCTGTTGGAAGAAAAGGATGCCGAATGTGCACGTACTGTACGTACAGAGACAGACACG
CCAAATGTGTGCAGAGCAGCAAACATAACACACGCCATGTGGCGCGAGCAGACGAGAGAGCGTGTAGCTCACATCCACAAAGAAAGTGCATTAACCTATT
CAAGCGCATATCACGTCTTCCAAACTGCAACGAGCCGGTGCACATTACTGTTCAGGTAAGGTATTTTAGA