Description :
From Genome Similarity Track
Location :
scaffold_57:18647- 24081
Transcript NameFunction/comments
g2319.t1 ABC transporters ABCA family

Sequence
5434 bases(100 bases per row)
CAGCCATGGCCGACGCAGGCTCCTCGGACGACGCCGAGAGCGCGACGCTCACCGCCCTCTCCGCCTGTGTGACGACTGTACTAGAGAACGATCTGACCTA
CGGCCTCTGCGTCACGAACTCGGGGCTCTTCGACTTACTGCCGTCGGAATTTCTGAATAGAAACAATACGGACTCTTCCTCGTCCTTCAGCTCCTCTGGC
TCTACAGACGACGACAGCGACTTCACGGGGGACTCGCCCTGTCGCGTCTTGTGCTCCAAGCAGACGTCGTCAGCTTCTGCCTCGTGCTGTGAAGCTGCAG
CTACTCTCCAAGCTTGCAACACGACGTCCACAGCTGTAACGACGTGCAAGGAGCTGTTCGACAGTGTCTTCACGTACCAGAACGAGTGCGACGGAGGCAT
TTCCTCTGCTAATACGATACTTATCGTCGTGGCCGTGGTCGTGGCTGTTGCAGTCGCGGCGGTCGCAGTCTTCTCGAGGCTCTACGGACGACGTAAGGGC
GATTTACACACGGGAATCGCAGCGAAAGTGGCTGCGACGTGGAGACAAATCACCAATTTGGTGTGGAAGAACATGGTACTACGCAGGAGACGCCCCGTGT
CTCTCGTAATGGAGCTCTTCCTGCCTGTGCTGCTGTCCACTGCTCTACTGCTGCTCGCCAACCTGGACAACATCGCGGGAGGGTGGAGATCCCAGTGGTT
CACGTCGGAAGCAGCTGTTCTCGACGCCAATGAGACGCTCATTTGCAGCGATCTGGCCGTCTGGGGGCTCGAGACAATTGGAGGACCGTCGTCCACCATG
ACGTCCTTCTACACGGGCGGACAGTCCGTCTTGGGGCTGTTTTTCCTTGTGAGTTACATTAAATTCGTGTCCACAACGACGACAACGATGGTCATTGAGA
AGGAGAACCGATTGCGGGAAGTGATGAAGATCATGGGCCTCTCGGACGCCACGCTGCTCTGCTCCTGGTGCCTCACCACTGCGGTGTTGGCCACTCCATT
GGCCTTTGCCATCTCCGCGGAGCTGAAATTCGGCAACGTCTTCCCTACGACCGAGTACGCGACGCTGGTGTTTCTCTTCTGGTCGTTGAGTGTAGCCATC
ACGGCGTTCTCGTACTTCGTGGCGCCGTTTTTCAACAAGTCCCGGACTGCAGCCATCGCGTCGGTTCTTCTGTGGCTCATTCTCTTCTTCCCGTTCTTCG
CGGTCCAGTCTGCAGACACGAACGCTCCTCGGTATTGGGCTGCTCTGTCGCCTCCCACTGCGTTCGCGCTGGCTGTGGACGAGATTCTACGCCGCGCTCA
GCTTGGAACGGGCTTCGCTTACTCTGTTGGGCTTCGGGAAGAACCAGTGACAGTCCCCAGTGCCTTCCGGATGAGTCTCTTCCTCATCCTTGACTCGGTC
ATTCTCGTGGCATTGGGATGGTACTTGGAGCAGGTTCTGCCTCAGCAGTACGGGGTTAGGAAGCCGTGGTACTTCCTGTTCACGAAAAGCTACTGGTTTA
ACAAGATGGGCCAGTCCATCGACGATGAAGTAGTGACGAGCTCGGACGGCCATGCCTCTCAAAGTTTATCACCGCAAGCAGGAGGGATTTACACTCAACT
GATGGACGGAGAGACGGTCAAAGCACCGGAATCTGGTACGCAGGCGTTCATAGAGCCTGTGAATTCGGCGTTAGCGATGCAAGAGCGCAATGGGACGTGT
CTCCAGATCCGGAGATTGCGGAAGGTCTTCCCACTGGACGAAGACGGAGAGGAACGAGTTGCAGTGAATGATCTGGATTTATCCATGTACAGTGGCCAAA
TTACGGCGCTTCTAGGCCACAACGGCGCTGGTAAGACGACAATTATCTCGATGTTGACGGGTCTCATCCCCCCGACGGCTGGAGATGCGACTTTGTATGG
CTGTTCTATCAAACGGGATTTCCATGAACTTCGACGGGTCATCGGCATTTGTCCTCAGCATGACGTGCTTTTTCAAGACCTTACGGTGGAGGAACATTTG
CTTCTCTTCGCTACGATGAAGCACGTTCCTCGCGGGAAACTCCAGGCCAGCGTGGATAAAATGATTGACGATGTGGGACTGACGGAGATCCGTCACGCGC
TGGCCAAGACGCTGTCTGGAGGCCAGAAACGGAAGCTCAGTGTGGCGCTCGCCTTCCTGGGCGGCAGTAAATTGGTGTTTCTGGACGAACCGACGTCCGG
CATGGACCCGTACTCTCGCCGATTCACGTGGAACTTACTCCAGCAGAGCCGCGACGATCGCGTCATTGTATTGACGACCCACTTCATGGACGAAGCGGAC
ATTCTTGGTGATCGTATCGCGATTTTGGCGGACGGGAAGTTGCGGTGTGCGGGGTCGTCGCTTTTCCTGAAGAACCGCTTCGGAGCTGGTTATAACCTGA
CGATGATCAAGTCGTCTGATGGATCTTGCGATGCTAACGCAGTAGAAGCGTTCCTCAAGAAACATGTGCCTGGAGTCAAGTGCCTGAGCAGTTCTGGGTC
GGAACTTGTGTTCCAGTTACCGACGGCTTCGTCCGAAGCGTTTCCGGCGATGCTGGAGTGTTTGGATGCCGAAATGCACACGCTGGGGGTCCAGCAGTAC
GGTATTTCAGTTACCACGCTGGAAGAAGTGTTTTTGCGGATTTCCCAGGACCAAGAGGAAGAGCAGGAGGCTGAAAGGGACGCTGTACTACCAGCGCTGG
AGAGGAAACCCTCTGCGTCTTTACAGGGCGGAAAATTGGTACCCGGAGCAGCAGTGAACTTGTCTTCGTCTTCAATCCCCATCACAGAACCTTCCATGTG
GACGCAGTATGTGGCATTGACAAAGAAGCGCTTTCAGATTGCCACGCGCGATAAGAAGACGCTGGCTTACTCGGTTGGTATCCCCCTCATCTTCTTGATT
ATCCTCGCTATTCTACCGGAGATCCAAGTGGCGGATTTTATTCCGAACTACGCGTCGAGTCTCCCTACTGAAGCCCAGCAGAGTACATGCACTGCGTCCA
CCAACTTCACTGGTCTCGTGAATGCCAACTACAACGTCTCGTCCTGCTTTGGCTCCCGTGGCTTCGACTTCTGTACGCTTGGTGTCCTGAATTGCGACGT
TAACGTGTGTTGCGACGCAGCCAACGTCGCTTCTCCCTGGTATCCCTGCAGCACGTGCGGATCTGCCCCATGCTTCAACAACAATTGTCTGGCCAAGAAC
AACGCCAAGCTCCAAGTGACGCTCAACGGGTTCTTAGTGGCGCTCGTTGTCATGTTGGCGTTCGCCTTCATTCCAGCAGCGATCGTCGCCTTCGTGGTCC
GTGAGAAGGACCCGATTCAGAACGCCAAGAGTCTGCAGCTCATCAGTGGAGCCAACGTGTCCGCGTACTGGATGGCAAGCTGGACGCACGACGCTCTCCT
TACGATCATCCCGATCATCGCGTCTGCTATTATCATCCCCTTGTCGATGACTCCGAGCGGGGCAGACAACGCCAGCACAGCCGATGTGTTCGCTATCATC
GTCCTAGTAATCGCCCACGTCTGGGCTATTATCCCACTCGCGTATCTCTTCTCCAGGCGCTACGTCAAGCACGCGGTGGCTCAGACGGCGCTGCTCGTGT
TTGCGTTGGGCACTGGGGGTTTACTCAGCATCTTCTCGTTCATGTGTCGCATCGTCAACTTCACCATATCGGGCTCGTTGACGCTTTCGTCACTGGATCG
GAACTATTTGCGCTGGATTTTCATGATCTTCCCAGGGTACACGCTGAACAACGGCATCTTCGAGTTGGCGACACGGAAAGTGAGTCGTCGAGCGCTGTTT
GGTTCTGCTCGTTTTCTTCGAGCGAGTCCGTCGTTCTTCGGACTCTTTGAAGGACTGGGCAAGGAGGAATGTACAGAGTGTTGGGACCGTATCACACCTT
CCTGTTGTGTGAGGCAGCCCTTCGACCTGGAGATCGTGGGAGCACCGCTGTTGTACACTGTGGTCGAAGCTGTTCTTCTCTCTGCACTCGTGTTTGTGCT
TGAAAATCGCTCCGCGAAGTGGAAACAGCAAGAGAAGAACGATTCTAGTGCGGTGGCTATGGAGATGGAGGAAGAAGACGAAGATGTGAGGCGCGAACGG
TTCCGTGTAGAGCAGGAAGCCCCGCGATCAACTGATCTGGTGTTCATCCGGAACTTACGACAGCAATACGCCGGCAAACCACGAGCGAAGGTCGCGTTGA
AGGACTTGTGTCTATCCGTTCAGAGCGGAGAATGCTTCGGTTACTTGGGTATCAACGGAGCGGGCAAATCGACGACGATGGCTGTACTCACGGGTCAATT
GGCACCTACCCAGGGCTTCGTGACGCTCAGTGGCTTCGACTTAGCGACCAGTTCGGCTTCCGCGCGCAAGACAATGGGTTATTGTCCTCAGTTCGACGCT
CTTCACGACCTTTTGACTGTGAAGGAGCAGCTTCAGCTCTACGCGAGGATTAAGGGCATCCCGGAAGCTTTTGTGGACACGGCAGTGGACGACAAGATCC
TGGAATTAGGACTCACCAAGTACCGGGACAAGCTCACGCGGGGTCTGAGCGGCGGCAACAAGCGCAAGGTATCGACAGCCATCGCGCTGCTCGGACGGCC
TCGCGTTGTGTTCCTGGACGAACCTTCGACTGGAGTGGACCCGAGTTCAAGGAGGAAAATGTGGGACGTCATCGCTCGCGTGTGTTCTGCGGATCGTGAG
GACGCAGCGTGTGTGGTGCTGACTACGCACAGCATGGAAGAGTGCGAGGCCCTTTGCTCTCGAGTGGGGATTCTCGTAAGTGGTCGGTTGAAGTGTCTTG
GGAGTGTGGAGCACCTCAAGCAGAAGTTCGGACGAGGTTACACGGTGGAAATCACGTTGCGCGCGTCAAGTGCTGATGCTGTGGAGCTCAAGACGATTGT
GGATCGGGTACGCGCGGTTCTGTCGACTGAGCGTAGTTCGTCGGGTAGAACGAGTCAGCGTCAGAGCTCAAGCAGCCTCCAAGTCACTGGAGCGAGGGTG
ACGTCCGCCAATATTCAAGACCTCTGCACTGTTCTGGGAGCTCCTGAACGTGGTGATCGCATTATGAACCGTTCGGGTACTGGCTGGTTGCTCAGCAGCC
AACTGGAGGCGCAGGGGTCGATTTCCGTCGACACTTTCAGCTCGTGGTGGGTATCTGAAACTCACGGTGAAAAACTGCAGAGTTTCTTCTACGACTCGTT
CCCAGGCAGCGTCTTAGCAGAGCAGCAAGGCGAACATTTCCGCTTCCAAGTCCCCAAGCACCGGCCCGACAGCTTGCACGTGCTGCGTCCGGCTGAGATT
TTCCGAGCTCTGGAGAAAACTCGAACAGATCTCAATGTTGACGAGTACAGCGTGAGTGAAACTGCGCTGGAACATATTTTCAACAACATGGCAGCGCAGC
AGGACGAGGAGAAGGGCGTAGCGCACGGCATGCA