Description :
From Genome Similarity Track
Location :
scaffold_19:186410- 188390
Transcript NameFunction/comments
g10863.t1hypothetical protein

Sequence
1980 bases(100 bases per row)
CCGTATTTCTGTCGATGGTGCGATTGGCAAGCGCGTATAACCGCAACAAATACAACGACAAGATGTTCACTTGCTTGAGCTCCTGGTCAACGAGAAACGT
TCGTAGTCGTGCTGCGACAACTAGATCCTTTCTCGGCCAACACACCTCACTGAACAACCTCGCCAAGGTTGTCATCATATTTTACTCCACGCTCACGTCG
GACGTGACGTTTGCAACTTGTCGGTTGCTGCTCATTACGCGTCCTCATCTTTGATCGCGAGACCCACCCAGGGTCCGCCATCTCTTTAGTTGGTTGACAT
CCTTCATTAACCCAATATTCCCCGAAGGGCACGTAACCTACAGAGTCCGAAAGGACTCATGCTTGACCCGGCTATCGCCATGCAACCTTCCCCACCTCCA
GATAGGCACACGGCGACACTAGAAAACTTTTCTGCTTACGTCTTGTCTTGAAACAAGCTTGAACGGTGCTCAGTCTCATCATACAGGTCGCGTAACGTGA
CATCCGTTGAGCAGCTCTCGTGTCGACGCAGCATTCTCCTCGAGCCTTACGTCTGCGCTGGGAGGTCTGCCAAGAGTAGCATTTTAAATGTGGCGGGTAA
CGACTCAGCAGCGAACAACGGGCTGTCGGGACTCCTTCAGCGATCTTCTTCTTCATCCTCGCCTGCGCAGAGAACGGCACTTGCGCAACGCTGGAGCTTG
GATCTTGGACGAGTGCGTTTGACGGAGCGAAGTAGCTTGCTAGAGCAGCGAAGCCTCGGGGCGTACCCAACAACACCTTCGAGAGGACCTTCGAATTGGC
TGCGGGTGCTGGGTTCATGAGAACAATGTTGAAGTGCGTACATGCTGCTCGACAATGCGTACGGCCAGCAATGGTTAGACTTGAGAGCTGCACGGTCAGA
TCTTCCCGTGTCTGGACTGGGCAGCAGCTCTCACTTTTGATTTTGATCAATTCATTGCGGCAAGAAATCCTCGGGAGCAAGGCTAGCTCCCCTCGCTAGA
GCTTTACACTTTCCTACACTGTGAAACATACGCAAGTTCATCAAACAATAGCCGACATTCACGTGTCGGGGGGGGTTAAGAGGTCCTCTATTTGTGTTTA
GCTAAGAAACTATAGAGTCCTGGTATCGCTGGAGGCTTTGCCTTATTGATAATCCTTTCTGTGGCTCAGTGTCGCTGCTGGTTTGCCGACATTCACGTGT
TGCCTCTGGATTTCAGACTAGTCGTATCCTCTGACATCGGTGAGCGGGGGTTAAAAAGCAACACTATTTATTAATAATGTACAACATACAGCAAATCTCA
ACAGAAACTACACAACAATGATTTTCCCACGATCAATTTTACTCAGAGGAAGCCGGTATGACATGGCATGGAGTGGCAGCATCAAGCATCAGCTTCTCGA
CCCAAGCAACCAGACAAGCCAACGCGGTGAAAATCCTGGACAATGTGCTCCAAGCACTCAAGAACATCGGAGACGCACCAAAGACGTAGCTCCGAATTGA
CAGTGTGGATAAAACAATCCAGAATGTCCTCAGTGCAAAACCAGCGACAACACAGCGCGACAGCCCCATCCAGGAACTGGATCAAGAGGTACGGTGCTTC
TTCGTTGTGCAATGGAGCACACCAGCAAAAGCCGACCTGAAAGCAGTTCGGACACTGACACAAACCCACAAGACTCGACAATTTTACCTACAACAACCCA
GCACAACAACAGACCCGATGCAAAGCTATCTATCAAACGTCAAACAACGAGATCAACCAGGAGCAACACCACCCAGACAGAGGCACGACATCGCGTCTTT
TATATTGACAAAAGGCTACTATAGAAACACATAAATATCAAATAGAAGGCCACTTAACCAACCAACTAAATGATTTTCCCACGACCAACATTGCTGACAA
ACTCATAGTTCGGTCTTCGATGATTTACTGCATCGACTTTAGTTTGGTATCCTGAGGGACCCGTATTTGCTGCCACCGTT