Description :
From Genome Similarity Track
Location :
Scaffold_182:18641- 20206
Transcript NameFunction/comments
Physo_158946long flagella protein LF4

Sequence
1565 bases(100 bases per row)
CGAGCGAGGACGAGTTGCCGCCTATCAACAACGCAGCGGGCGGGCGAGGCTTGGGAAGCATAACAAAGAGCAAGGCGAACAAGTATTCTTATGGAAGCAA
GAATGGCAACAATAACAAGGCTAGTGAGGGGAGCCAAGGCGGGGGATCGCTGTACTCGGGGACTTCATCAAAGCCATCTAAAAGCGTACTCTCGACCGGA
GCCAGCACAAATCGGTCATCATATCAAGACGCCAAGAGCCGAAAGATCGTGGCCAACGTGACGCTGAAGAAAGGTATACCGTCTGCGCGAACTAAGAAGA
TCGTGGGCAGCTCCGCGGCGTACGCAGACGTCTCAGGTAGGGGCTAACAATGCAACTTCAACGTTGGAAGATTTTTTTTTAGTTTCAATTTTCGCTGACA
AATTCCATGCGTGCCACTTGAGCAGGCTCCAAGTCCCGGCGCAAGTGATACAGGTTAGTTTCCGTCATGCAGCAAAATAGTAGCTAGGGACCAAACCAAC
TCGCAAGTAGCTTCCGTGTGCCTCCGTGCGTGAAATATGACAAGCTAAAAGTGTTGTCGGGGTTTTGGTTCTTGTCCGTATTGCTATTTCCCGCAGTGCC
AGCTGGCTACAAAATACAATCTGCCAGTTCCGAGTCAAATCTCAAAAGAAGAAGCGCGATACAAAAGAGCCCAAGCCCAGGAATGAACATGTTCGGAACC
CGCGTGGCCCCCGCGACGTCGTCGTGGAACATGGCGACGATGATGAAGACCAGCGGCATCACGGAGGACGTGCAGCAGCACCTCGTGCGCGTGTACGCGA
CGCTGTCCGCCTGCGTGCTGGCCGCCATGCTGAGCGCGGGCTGCACGCTGTACTTCGGCCCGGAGCGCTGGTCCTTCATGGGCTCGTCGTTCGTGACCAC
GATGGGCTCCATCTGGCTCTACATGGAGCCCGTGCAGAACTACAACCGGCGCTTCGGCATCCTCATGATGATCTCGGCCGCCATGGGGCTCAGCGTCTCG
ACGCTCGTCGCTGTCGCCGTCCAGGTGGACCCCAGCATCCTCGTCTCGGCCCTGTAAGAGCCTCGTTTCTCTAGTTGCTGGCGGATAAAGTAGGTTTATA
CTAATGTGTGGTTGTGTTTATTTCTTGACAGGCTTCTGACGACGCTGGTGTTCCTGTGCTTCACTGGAAGCGCCCTGATCGGTGCGATACCAGGATGGTT
TTGTAATGCTAATTGCTGCGGGAGCAAGCTGACGAGTTGGCATTGTTATGGTAAATTATTATTTTTTTCTGCTGCAGCTACCCGCCGCGCGTACCTGTAC
CTCGGTGGCATTCTGAGCTCGGCGCTGTCGCTCCTGTTCATGACCAGCGTCCTCAACATCTTCACCCACTCGTCGTTCCTGTTCAACATGAACCTGGTAG
GAGCAACGCACTGAAGGATGTCGACGTGCTGAGCTAACTTGTTGTTTCGTTGTGTACGTGTTTCCTGTGCTGCAGTACGGCGGACTCTTCATGTTCTGCG
GGTACGTGGTGTTCGACACGCAGATGATCATCGAGAAGGCCAGCATGGGCGACAAGGACGTGCTG