Description :
From Genome Similarity Track
Location :
Scaffold_587:1864- 6126
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_587-fgenesh-gene-0.2General transcription factor IIH subunit
Pytiw_DAOMBR242034maker-piw_contig_587-snap-gene-0.6Cleavage induced predicted protein
Pytiw_DAOMBR242034maker-piw_contig_587-snap-gene-0.7Conserved gene of unknown function

Sequence
4262 bases(100 bases per row)
AGGTTCGGCAGCCGCGCGACAATGTCCACAAACACGCTCAGCATCGCCACGTGCAGCGTCGAGTTGGTGTACGCGTACACCTTGAAGTTCGTCTCGACGA
CGAGGAGCAGCTCCGAGCCCACGTCCACCGACGGCGCGCTTCGTGGGTCGGCCTGTGAGCGCATCCCGGACCGGACCCCGGCGAAGGAGCTCGTGAGGTT
TATGAGACTGCGCTTCTGGCCTGTGGACCCGCCAAAGATGAGATTCACGGCGAGGCTCGTGGTGTAGAAGCGGTCCGAGGTTGTGCGCTTCCGGTACAGG
AGGCCAAAGTCGATAAAGTCGCCCAGCAGCAGCTGCTGCGTCTTGGTCAGGTCGCTCGCGGCGTAGAACTCGTTTGTCTGGCAGTAGCTAGCTCGTAGTG
TAACATATACAGTTAGCAAGGTATACGAGTCCTTGGGGGACATGTACACAAGTATATACCAACCTGATCTGGAACAGGAACTGCAGGATGTCCTCCTGCT
TGAGCGCGCCCGAGTTGTCGAGCGTCTTGATGTACTCGAGCATGAAGATCCACATCTGCACGTGGATGTCCTTGAGCATGAACTCGTAGCCCGTGTCCGT
GATGTGGTACGCGCGCTTGTCGGAGCTCTGCTGCATGAGCTTCGTGCGCAGCAGGATCTCGACGACGGACTGCGGCGGCTCCTTCACGGCCGTCGATCCC
ACCATGAAGTGCAGCACCGAGTCCCAGCGCGAGCGCGCGTAGCGCTCGAGCTCGAGCGACGAGATGCTCGTCTCCGTCTCCTTGCCGAGCTTCAGGCGCC
CGGCCTCCCAGGGCGAGCCGCCCAGGTTACTCAGTGCGTACTACACGACACACACCATTCGAAATGAGAGGGTTACGTTAGTCAGTTCTGCAACCAACCA
TCCAAGCAAATCCTGGTTGTATCATGTGTGGTTATGGTACCCGGAGCTGTTTCTGGAACGCCGGATGCGGCTGGTACGAGTCCTTGGTGACCAGCAGAAA
CACGCGCAGACGCACGAGTTTGCCCAGCGCGTGGTCGAACTGCGGCGGCATCTTGGGCACGTGGGTACCGTTGTGGGGTGACGTCACCGCCGCGAGCTCC
GCTGCGCCCGTGGGCAGCGGATGCACCCATTGCTGCAGCGCGTGGCGGCCGATGGGCGCGTCACAGGCGAGCAGACGCACCACGAACTGCTGCGCGAGTG
CCGGCAGCGCCTGGAAGACCGCCTGGCACGCCCACGGGTCCTCATACAGACGCTCGAGCGTCGCGTTCGGCAGCGTCTCGAGGAACTCGAACGCGTCCAT
TTTCAAAAGTGACCGATCCGAAACCCGCCCTTTCAGCCGATGTTGCATGAAATATAGGACCGAGCTTGTATTATAGTGCGTAATTTTTATTTATTCTTTT
TTTCTTTTGCTTGAACAGTTTAGTGCACAAATTTCTGCCTTAATCAAGTGAGGACTCTGAAAAGACTTGAAAGAGAATGAGGTGGGCAATACTGGACCAC
CAACAAGTAATTTCTTCAAAAGGCCTCTTCACATTGACTTAAACAACAAGGGGGGAGGGGGAGGTAACATTCATAATGGATTTGGGTGGTGGGTGGTCCA
AAATAGGAAGTCCAATGACGGATTTGAGTCCTACGGAAGGGTCTAAAACTGAGCGCACAATGACAGAAAGGCAATATACTTAGTTTAGGAAGGTACTTAG
ACATGTGGTGTTTGCGCGCTAAGCACACGTAACGATCAGTCTCATGCTGACTGACAAGAGCTCAATCGCTCGAGCTTCCTGACCAAAATCGATGCGATCG
TCGCTCGTTGCGCAGCTACTACCGCAGCCTCGACTACGCCCTACAGCGAGTTCGCTCGATGTCTTGGCTGCGTACCTCGACAGTTGGTTCAAAAACTAAT
AACTAAGTCGGCGAGTGGAATAAAGTGAAAACACCAGGCTCACCATTGGCCCATTGCACGCCAATCATCTGCACACGGAGCAACTTGTTCATATATTTGA
GAAGTTTAGATTCTTGGACAAAGGACGTGTAGTAAAAAAAAAAAAAACTCTAATCTATGTGCGACACGTTCAAAATGACCCATTTTAGACGCGTGGGTCG
CTCCCACACGTACTCTCTTGGACATCTAGCCACACAACCACATAGCCACTTTCCGAAACCAACAAACAAACAAAAATACGCGCTCCAACACCAAGAGCTC
ACGACCGCTAGAGCCACAGTGCTCACAACTACCACTGCAGTACTCCCGACCACCAGGACAACACCGCTCACGCCCACAACCGCCACAACACTCACATCCA
CCAGCACAGCGCTCATGACAACAAGGGTCGGTCCCAGTGCTCACGATCACAACGGCCACAGCGCTCTTGTCGGCCAGCACACCCTCGCCCATCAAGGCCA
CACGGCCAGGCCCACCAGCATACCGCTCTCGCCCACCAGGGCCACATGGCTCGTGGTCTCTAGCACAGCACTCACGACCGGTACGGCCGGCGGTCCAGCG
CTCGACTCCTCGATACGCTCCTACCGCAGTGCCACTCTCGACAAAAAAGATCTTATGTGGTTTCGCTCAATCTTGCGAGCTGACTACCTGAATCGGATAC
CTTTGGCTCACTTCACCAGGTCCCATCCCCGGAGGTCGACATCTACATGGACGCGAGCGACTTCGGACTCAGTGCAGCGTTCCCAGCACGACAGGAGTAC
CTTCAAGTCCAGTTCGACACAGACGAGCTTCAGTTGATTGCGGAATTCAAGAACAATTCAAGTAGCTCATTTGGCACCAACGTCAGAAAGCTCATGAGCG
TGGTGTTCGCGTCGCTAGTCTGGCACCACGCATGGACACCCGCTACGAAGATGCGTGACACTCACGTGCGCATGTTCGTCGACAACCAGACGGCGGTCTC
GTGGAACAATCGCCGGGCTTCAAGAAACGAATTTGCGCAAATGCTCCTCCGGATCATGAGGATCTTGGAGGTGCCAAGAACAACCAATTTGGTCGAGAAG
AAGCTCGCTTCCAGCATGCAACACGAGATCCAGTGCTGTGTCCAGTTCGAACTGCAAGGTGGCTTCTGAAAGGCGCCCGAGTGATGGGGACGCTGCCACA
TCAGCCGGCTATGCGAACGAAGGGCTGCGCCGGTGTCACTTCAGCACAAGTGTCAAGAGCAATTAAAACAGCAACACGTGCGACCGGTGAAGACCCCATG
CGATTCTCCACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACCATGCGAACGAAGGGCGGC
GCCGGTGTCACTTCAGCGCAAGTATCAAGAGCAATTAAAGCAGCAGCACGTGCGGCCGGTGAAGACCCCATGCGATTCTCCACTCACTCAATTCGAATCG
GCGGCGCCACCAAGCTGCTGAACGTGGGAGCAGACCGACTCGTTATCAAGTTTCTTGGGAGGTGGCTCTCTAACGCGTTCGAGGAGTATCCAGTGCTCTC
CGCGGATGACGCCAGAGGAGTCTCAGATTTGATGTGTTAGCGCCAACCGACCCAGGACTTTCGTGACNNNNNNNNNNAACGCGGGAGCAGGCCGCCTCGT
TATCTAGCTTCTTGGGAGGTGACTCTCTAACGCGTTCAAGGAATATCCAGTGCTCTCCGCGGATGGCACCAGAGGAATCTCAGACTTGATGTGCTAGCGC
CAACCGACCCAGGACTTTCGTGACAGATTCTGCTACCGCGGGGGTGCCGCCACTCCACTTCCAGATCTGATGGAGCAACAAGAAGTCTGAAGTTCCCCCT
CGAGTCGATCATTGGAAACAGCTCGCCTCCGCAGCATCAACACGCGCTTCCCTTGGCGTCGCTCCAAGCAGTACTGCCGCCAAGCCGCGCGCTACAACAG
TCCGATTTGCAGTTGCCCTGGCTACACCAGTACAATTGTCCATGCAAGTTGCCTCTACACGCTCGCTGGACTCCATTCAAGTGTCATCGGTAGGAGCAAT
TGCTCCCACTTGAGAGTCCAGCCTAGCGAACGTCGACTTCGATCCAACGCGATCATCATGCCACGAGCGTCGATCAGGCACTCGTGCAGTCCATGAGGCG
GTACCACGAATCTCGACCGTGCCGCCGAGACCGCCGCAGAGCTCTCAAGCAGTGCCAGATCACTGACGGCAAGTCGCGCTCTCACGAGCAACAGCTCGAT
CGATCCAAGTACAACTTGAAGAGGAGCTACTTCGTCACGAGGTTTATGTCTCATCTCGGCTT