Description :
From Genome Similarity Track
Location :
Scaffold_678:1864- 5964
Sequence
4100 bases(100 bases per row)
GATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCATCTCTCTGAGAGGTTTGAT
CTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAAC
CATCGTCCGATCTCCTCATAATGGTCCAGTAATAGGCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAG
GTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGT
CTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAGCGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAGCAAAGTGTCCCATCCGCC
AGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAGCCAATACACCAAAC
AACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTTGTACGGTACACGCCTTCACCAATCCCAACGCAGTCTTGGATCCGACTCCCATCCACTTGGCA
CCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTG
GCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATC
CAGTGACCTGACAGACCTTAGGTGGATCCGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTC
TCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAGCTGACACTTCATGTAGATCA
CGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGAATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCG
GATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTG
TAGAATTCTTTCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGTATGACCTTTCTTGCCACACT
TCTCACTGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGA
TCTGTACATCCCACGGTCCCCGGGTACGGTATCCTCCGGTCGAGAGTTGTCTTCGGTCTTCGCCGCTCGATCGTTGGACGCAGTGAGACAGACTCGACGG
TAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGGGGACACGTCGAGCTGGGGCCGTAGGCGTCG
GAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGTTCGTCTGCGTC
GGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCCCCCACCGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCC
TTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTG
CCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAATTTCT
GGCTGGTTTTGCTAGCAGATCCGCAAAGGTCAGACACTTCTCGGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACCTTGCTGATCCATGTTCTC
GCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCTGGCTG
CGGCTGTTGCTACCACCGCTGACGACGGGGGTGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGCTGTCTCCCTCCACGGACTCCATCTCCAC
GTTTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGC
TGCAGGGTGCCTGAGGAGGTGTCGGAAGAGCCTGTGGCCGGCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTTGAGTCCGATCTGACGATA
ACCCCACTGGCTTCTTACCGGGTCTGGTTCGATCCTGGCTGGATTGTATCAGATTACGGGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGAC
TTCCTGTCCCCGGATCCTCGCTCGCGCTTCCAGCATGGATGCCCCGGAGGGCCTAAAGTCATGCGTCGTGGTTCGGACGACGCGTCTGACTCATCCTCAG
CGGCGGATTCGTAGTTCGAGGACGCAGCTTGTCTGATCCTCGGCGACGACACTGGATCCCTAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGC
AAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAA
CGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGTTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCA
TGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTCGACCTGGATCCAGCTTGGTCTTC
TTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTT
GGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAGGATCCGCAGGGGTCCCCG
AGGGGACCTGGGGAGGATAGAGAGGTTTCTCTACTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGC
GGATCTTGTTTCATTCAGCAGCGTCTTCATCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGAACTCACGA
TGAAATCCCGAGTCACCAAAAGATACGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGTTTGCCAGATCCAACTTACCAACTGCG
CCCAGACACCGACTAACGGAGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCG
GTATCTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGG
ATGGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTC
GTAGTTCCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCTCAAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCT