Description :
From Genome Similarity Track
Location :
Scaffold_43:186381- 188106
Transcript NameFunction/comments
g2079.t1XP_009524611.1 hypothetical protein PHYSODRAFT_493303 [Phytophthora sojae
g2080.t1XP_009524612.1 hypothetical protein PHYSODRAFT_354429 [Phytophthora sojae

Sequence
1725 bases(100 bases per row)
GCTGGCGCACGAGAACCAGACGCTCATGCAGCAACTCGAGGCGCAGAAGGCGCAGGAGTCCCCCACGAGTTCTAGCCAACCCGAGGTACGTCTCCCACTA
AGTTTTGATTGCAAGTATAGGAGCTCACGGTTGCGGTGTCTATGATGTCATGTAGGACAAGCAGGTGGCCAAGCCCGACGAGATGAAGGAGGAAATACGG
GAGGAGGACGAACGCCCGGCGCCGGAGATCAAGTGGGAAGCGCGGACATTCGAGTGGTGAACTACCCTCGCATCCTTCAAAATAAAGTTACAGCTTGTAC
AGCCCCGTAGAGAGCCTGGGCATCCTCTCGCCATAGACAACAAACACCACCACCGATCAGCCAGGGAGGTCCTTCGAAGTATTGTACGCCTTGCGACGAC
GCTGCGCACGATGGAGGTCTCATTCAGCCAAGAAAGGTCCCTACAAGATGATCTTAGTATAAGTGTTAACGTTAAGAGTGCATTCCTCCAGCGCTCCGCA
TTCGCAGCCCCCAGGACTCTTCTCGTGGGGCATGTGGCATTACCATGGACACAGCATCAAGTCCGACTTCCACCTGAGCAAATCCCGGCTCCTGTTCCGC
TGCCTTACTTCCCTCCACGCGCAGCTTAGGATACCGAAGCGCCTAGCCTACGGGTCCATGGTCTGACGAGAGAACATCTCCTTGGCGATGATCATGCGCT
GGATCTGAGACGTGCCCTCGTAGATCTGGTAGATCTTGGCGTCGCGGAAGAGCTTCTCCACGGGGTACTCCGTGTTGAACCCGGCGCCGCCGAAGATCTG
AATGGCATCCGTGGCCACCTTGTTGGCGTGGTCACCGGCGAACCGCTTGGCCATGGACGCGTACATGGTGTTCTTGCGTCCGCAGTCGATCTCGTACGCA
GCCTTGTACGTCAGCTGGCGGCCCGCCTCAATGCCCGTGGCCATGTCGGCCAGCATGAACTGGATGGCCTGGTGCATGGCAATAGGCACGCCCATGGTCT
TCCGCTCCAGTGCGTACTTGCGGGCCTCGTCGAAGGCCCGACGCGCCAGTCCGACGGCGCCGATGGCCACGGGCGGGCGTGTGATGTCGAAGGCCTGCAT
GGCAATCTTGAAGCCGTAGCCAGGGTCGCCCAGCACGTTCTCCTCGGGCACCACCACGTCCTCAAAGGAGATGCCGCGCGTGTCCGAGCAGCGCTGGCCG
ATGTTAATCTCCTTGCGGCCGACCGTAATGCCGGGCGTGTCGGCGTCCACGATGAAGCCCGTGAAGGCCGCGCCGGCGTTAGCGCTCGGGTCCGTCTTGG
CCAGCACGAAAAACCACTTGGCCACGCCGCCGTTGGTGATCCACATCTTGGACCCGTTGATGACCCACTTGTCGCCCTTCTTGACGGCCGACGTCTTGGA
CCCGGCCACGTCCGAGCCAGCGCCGGGCTCCGTGACGCAGTAGGCGGCCTGCACGGGCTCGTCCACGAGGCGACCCAGGTACTTTTTGTTCTGCGCGTCC
GAGCCGGCCACCAGCAGCGGGGCCGTGGCCAGGCCGTTGGCCTCCATGGCCGTGGCCATGCCCGTGCAACCGTACGCCAGCTCCTCGCCGATGATGCAGC
CGTCCAGCGAGCCCAGGCCCAGGCCTCCGAACTTCTCGGGCACGTGCGTGTTGACGAGGCCGAGCTCCCAGGCCTTCTCGAAGATGTCCTGCGGGTACAG
CATGCTCTGGTCGTAGTGCTTCTCC