Description :
From Genome Similarity Track
Location :
Scaffold_516:18635- 23968
Transcript NameFunction/comments
g11388.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g11389.t1hypothetical protein

Sequence
5333 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCTATCCAATGGCAAAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATATTTGCGGATACAAGTATACTGAACTTA
AGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGCGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGAGTAAGAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTTGTCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGT
CTACAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGCCGACGGTCATTGGAGAAGCGGCGGTAGC
AACGATGTTGCGTACGCTATCGCCGACGGAGCAACACGGTGTTACTCTGGGTTTCGTCGTGAAGGAACAGCGTGAAACCACTTCTCGAGCTTCGGTGTCG
CCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACA
CTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCAGGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCG
ACTCACAGACCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAATGAGTTCCGATCGAGGGCGGAG
TTCCTCGATCTGCAACAGGGCAAGCATGACGTGTATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCCAACATCGTGACCAACCCGATCGACGAGGCGA
CAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGTCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTCGC
AATGCAAGAAGAGTTTAGCCTGAGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCA
ATGGACCTCTCGAATGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGTATCAACGAATGTGCGTTGTTTCCGATGCGGAAACATCGGTCACTATGCCCGCG
AGTGCACAGCACCTGTGCACGCGGCGAGAAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGC
CCTGCTGGTGATGCGATCGAGCGTGTCGACATCAGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACA
AGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAG
CCTTCCAAGGCTTGACTTCGAGGAGGTGACAACACCTCGAAGTGTATTGGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTA
CATGTACGCTTCTCGTATCAAGAGAAGGAGTTCGTCGACGAGCATATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTG
CATGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCAACAGAGAGCGATGGCCCTGTCGGCGCAGCACA
TGCACCACGTGGTGCATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCGAAGCGAACGCCAACGACTGCGAGAGTCGTTGGA
AGAAGATGTGAAACGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACAGATAATGTCGACA
CACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAAC
GTCCCGCACCGGAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACAGACGAAGAGGTGCTGGATCAAGCCGGGCTTAAACGCGTGGCGCCCGCGGGGTA
GAACCCGCCGGCGAATACAAGGAACAACTGTCCCCGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTACGCACGAGAAGTGAACGGCGCAAGT
CTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACACTGAGTGTCTTGACGCGTACGAGTAT
TGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAA
CTGCACGATGGACGCATCGAGCAGATCTGCATTCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGG
ACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTAGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCATGAGTACAAGGA
TGTACTCCCGGACGACATTCCTGCGGACTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACCCGACAG
TGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGC
CTACGTTCTGTGTGAAGAAACCACAGGGTGGGTGGCGCATCGTTCATGCGTATAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCG
AAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATT
CCTCTCGCAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTAATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCA
CGCACTTGGTGCGCTTGGTGCGCAACTTTGCACCGAGCTATTTCGATGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGATGCA
TACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCGTACTTG
GGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAGTT
CCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTGAAGAAAGAAGCTGCAGGGGAATGG
ACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTTCACGTTGTGT
GCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCACCTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGC
TGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGGTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTC
TACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGG
TTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGATGCCGACGCCAACGCAGTTGGCGTCGT
CAGGACGACTACACCCTCGTCGTCCTTGTTGGACGACGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACGTCTCCACACCT
TCTGACAAGTCTCGTCAAAAGCTGGCCAAACACCTTCGTGCTCGTGTACACCGCTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACA
ACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAA
GACATACTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCT
GCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTGGGTCTTCCGCAAGACAACA
AGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAACAAGATGGTACATCTTGCTGCAGTACCAGCCGAAGTGACAGCCAAACAGACGGCATGTCT
GTTTGTCGACATGGTGTTTAGACACCATGGCATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACA
CTTCTTGGGATGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGAGTGTTGGTTGACACCATGAAGAGCT
ACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGT
GAATGTCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGC
ACGCTGATACAAGCAATGTATCAGCTGTGACGA