Description :
From Genome Similarity Track
Location :
Scaffold_126:186323- 194216
Sequence
7893 bases(100 bases per row)
CCAGAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGA
AGTTCGTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCA
GAGCCTGATGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGTATGTGCGGGAGAACCTGCAG
GCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCC
GAGAAGTAGAGCTCGCGATGGACACGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGT
GTACACTCGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCAAACTACGAGTACCGC
CAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCAC
TCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCACCCTTGAAGAGGCG
ATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGCC
CCAACGGACCAGTTCCCATGGAGCTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCATTTCAAGCGCGACTGTCCCGC
GGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATTCCGGGGACAGGGAAACGCCGGGAACCAGTAGGGG
CGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCATACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATC
GGCGAAGAGCAGCGGCGGGCTGCTCGTAGTACACATATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTC
GCACGCCGCCAGACGGCTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGA
AGGTCGTCACTGTCCACAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGA
TATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCA
TTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTAT
ATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGAC
AGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGAAAGACGTCGGA
TACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACATCAGTAT
CATACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGTAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAACGACGCCACCG
CCGCCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGC
TATCACATCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAA
TGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTC
TGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGCTCTGAGATTCTCAACAACCCCAAGGATCCGGTGTATCCTTTG
ATGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGT
ATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAA
ATCCCCGCCCTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTAGAACAAGCTGAACAACGCAACGGTGCCGGCC
CAAACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGACCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGA
TGCGAGAGAGTGACATCCCGCTCACCGCGGTTAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGAC
GTTCATTCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAG
ACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCAC
CAGAGATTAAAGTTATCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCCGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCA
GAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAG
GACGTCGACTGGCGCTGGGAACAAGAGCACCAGAATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGA
AGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACATGAACGAGTCATCTCGTTCCAGTC
CCGGCAGCTCAAAAGGGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCATGTTCACCTTCTGGGC
TCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCG
CGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCG
GGTGACAACGGATCTATGTGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAAG
TCCGACTGGCTCTCGTTGCGACAGCGCTCACGGCTCCACCAATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGAAGCCCACTGATCCTCCACGTG
TGGTTGTACCCAACGACGAGGATCTAAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTAGGCCACGAGAAGACCTTTCTGTC
GGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCTCGGTACGTTAGGACATGCGAAACATGTTAGCGAATCAAAACCGCAGGGCACTCT
TCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATTAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCG
GAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGG
CGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGCTCACTGCCGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACT
CGTCTGCAGATGTCCACTGCGGATCATCCGCAAACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAG
CGCCACGTACGTGGTCGTCGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTT
CCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGAT
GTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAAATA
AACAATAGGAGTACTCCGACAAACATGGAAGAGGAAGCTTAAGTGTATTTAAAGTGGGGGACTTAGTGTTACTAGACACGAGGAACCTACCTCTTGACAC
TGTCAGCTCTGTCGGCAGCAACAAGGCGTAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAG
TCAATGACGACGCACCCGACGCTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGACCCACCTTTGCCCAGCTCCTC
AAAGCGAGGACGGGCCACAGACGTCAACGAGGGCGTCGGATCAGGCGCCCAAGCCTCGGTCTGGACGGCAAAGCTGCGGTCATAACCGTACGCCGGAGGG
GCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGTACGCTGAGTACGCCGGGCACGCACCATACGCGTATGTGCCGCAGGCGGCTCCGGACGTGGCAA
CAGATCCTTGATGCATCGAATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCATGCTCGCAACCTCTCGCTCC
AGCAGGTCCAGGCGGCCCGCAAGAAGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAAGCGCAATCTCAAGCA
CGAGGACACGTTGACGGAGGCGGTCAGCCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCGTTCGGGAGACGCCAAGTACTC
GTACTCGTACGAGGGCACCTCCGCCTCTGCTTGACCTGAATGGAGATGTCCACTTCCACGTGGAGCGGATCCTCCAGGCGCAACGGTGTCGGTAAGCGAC
AGCTCCTCGTGAAGTGGAGGGGTTATTCCCACTCCGAGAACGCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGATGGCTGTCGCAATCTGGGA
ACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATAGACTCCGTACCCGCGCTCATCGCGAGCGCTGG
AAGCCGCACGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGTGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAG
CTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGTGTACTTGAGAGATGCAACCCATGCCCAGAACATGTCCTCACAGGAACTCCAGGTGGGACAGTTC
TCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTG
GCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCC
CACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCCCTTGAGCTGATGGCAGCTCCCTGG
CTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGAAGCTCAACAG
TGGCACCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTT
AGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCATCGGCAAGCGAGAGACGTTTGCGAGGATTCTCT
TCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAGCGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGG
GCGACTGCACGCTACCTACTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTCGGCATCGTC
TTCACTGCCCGAGTTGAGCTCGCGTTCTACGAACCGAGGGTTCGGACGGTTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCC
GCAGCCGCGTCATTCGAGGAACCGATCGCCTTGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCG
CCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCGCGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACA
GGTTGCTGCTCGAGGCTCTAGCTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACA
CCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGGGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACT
TCACACTTCCGGGGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAAGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTA
TAGGTAACTAATAGTTTGTATTAAACCCGAACTTATCCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGTTCTCTCTAATAA
AAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACA