Description :
From Genome Similarity Track
Location :
Scaffold_85:18632- 24873
Transcript NameFunction/comments
Phymu_g3834hypothetical protein
Phymu_g3835hypothetical protein

Sequence
6241 bases(100 bases per row)
GTTTATGCTGCCGACCTCCTCTCTTGATGGCCTCCTTCCTGGCCTTCCACGTGCTCTCGTGCCCTCCGCGACGCATggcgagctccagctcctgctccag
aTCGTTGTTGCGCGCGTCGAACCGCTCCAGTTCGGTCAGTGCGATCCACTCGAACAGCGGCACGATGCTCAGAGCGCCCGGAGCCAAAAGAGTCGTAGCC
ACTTGTCTAGCGAACCTCAGAGCGCTCTGAGGGGTGGGGAAACACTGGTAAACGTGCACTACGATAGCCTCAATGCACGTGGCCCCGGGCGGTTGAAGAC
AGACGCTCACACATGCGAAGCGCTGGCCTGTGGCCTGCGGCAGGTCTGAGGCGCTGAACTGGGCGGCATCGCTGACGCCTAGAGCCACACTGGGGAAGTT
CTCCAGCGCCATCGTcatctcgtcctccttgtaGACTGCGAAGCGGCTGCAGTCACGGATGTCCGATATCCCAGCGGTTTTCTCGACTGCGCAGATCTGG
CGGAACAGCTCCAGGGCGTCCTCGATGTCTCGGAACTTGCCGAACACCCGGAAGCGCGTGAACTCTGGATGGGGAACAGTGCTTACAGCTGCCACCGCTG
CTTTGCGGAGCTGATCCGCAGCAGACTTTGCTGATCTGGACGTTTTGCTCGTagacaacgacagcgagatGCCCCTGGATGCCGGTCGAGCGGCCTGTTC
TTTCATGAATCCCAGCACGGCAAAAGGCTGACACACGCCGTGGATGGGGTCCCAAATCGTGGCGGCAGTGGCAATCGCAGTCGTCGACGCTCCTGTGATG
CCGTTTTTTGCAGCGATGAGCGCATtgtcgagcttctccactcgaACTCGTCCGCAACGACGCAACTCGCTGCGAAATTCCGTCGTTACCGCCGTGATCG
GAGACGCCGTAGTCAGCAGAGCTCGGGTGCTCTTTTCTAtattgctgctgtcggccCGACGATTCAGTGTTTTACTACTACCGGAACGCGCGAGGGCGAG
TGGTAGTGAGTGAGGAGTAGCGGTTGACTCGTCGTGTGGCACAGGGGGCAACTTCGCCCGACTTCCTCCATGCTGCAATTTCGTGCTTGTTGAATGCTCT
CGCTGAAGAGGTGACACTGAAGTGGATCGAGTCCCTGTTGCAGGGAGAGCTACAGTGCCAGCATTGTCTTGAGAATTATGTTGTATTTCCTCTGCAATTA
CGGCGCTTTCTTGGGCTTCCTTTGGGCTTCCATTTGTTTGCTTCGCCTGCGTTCCAGATGCACAGACCTTCGACACTCCTCGTCGACGTTCCAGCATGAG
AGAACCAGGGTCAACCAAGACGCTAGCATCGTTCAGCGGCAGTAGTGGAGCAGACTGTGATTTCCCTAGCGTGGTTCCTTGGCGAATAGAAATTGCACCT
CGATCGGACCGTCCTCCAAAGGATCCAAACGCTTGAGGGTGACTTTCAGTCATGACACTACTGATGAACGACTTTTTGTACTTTTCCCACGCCACAGACT
TAAGTGCTCGACTCTGGATGGACTCTCGGATGTATCCGTTCGAGGATCGCTGCAGACTCGCACGAGCTTCTGCCGACATGAGGTGGAAAATATCAAACCG
TGAAAGCACGAGGATCTTCATGGGCGATTCCGCCAAGATGGAGTATTCGCGGATGAAAATGTCGTTGAATCTCCCTGCCGATGCCCTGTGTGCAGCAACA
CGTTAGAAGCAGTTTTTTACACCTGCGGAATAATACAATCAAGCCTTACTCTGCGCAGCCCAAGACCGAATTTGGTCCATATCTCCCCAGCTCGTAGATC
TGTCGCGCGTTGGTGATCGGGTGCTTTCCTTCATTTATGATTCGGCATTCACCTCGAGTCACGATGAACAGTTCACTGGCTCGAGATCCCTATTTACACG
AAAACCTGTCAGTGAACCGAAGCCTCAAGTCTTTCCGATGAGTGTCGATATCCTTACCTGCTTGCATATTTCGCCTTTGTACGGGATGTACTTCTCCGTC
ATGACCGAACACATACCTTCAATAGTATTGTCATCCCACTCGGGACCGAGGAAATACGGGTTCTTTCTCAGCATCTGCGCGTACTGGGCGTGATACTCGT
TCTGATACTTTTGGATCAATGGCTCGTACTCATCACGGCcgaggacaagcagctcgcagaACTCGGTGCACACAACGGTAGCGCGACGTACGCCATCAGC
CTGGGAAAGCGCTAATTCGCCGAAATACTCGCCCTCCCCGAGCCTTGACACAACGCTTTCTTTCGTCTCTTCGAAGCGATTCTTCGCTCGGACCGATACA
TCCACGCAGCCCGTAAAAATGATGTAAAAATGCCTCCCCACTTGGCCTTCAGCGAAAAGCACAGTGTTCGTGACAGCACTAACGAGCCGCATAACATTGC
ACAGCTGCTTCCGGACTTCAAACGAGAACcgcgagaagaacttgacgctCTTTAGATATTCGACAGCGAACTTCAAATCCTTCTCTGATCGTTGGGCCGA
GCTTCGCATGAAAATATTCCTCACAATGTCCTTGTTGCTGCGGAAGCGCTTGGTTATCTCGAGCGTATTCGTGTTACTAGAGTCGTGTGACTCCTTGAGG
AGCTCACTAAACACGACTCGATTGATAAAAACAAGCTCCGTTGGTGCACTTAAAACAATCACGGATGCTAAGAACAGATAAAAACTGAGCTAACGCCGCC
ATCAAATTCAGATAAGGAGGCTCTTACCAGCGCGTACATCTGTGCTGGAAAGCAAGGCACGCTCCCCAAAGGTATCTCCTGGCCCCAAGACAACTAAACG
AATGATCCCATTCACCCGAGTTGGGTCATGTTTAACCACGTCCACTGTACATACAAAGCGTTAGCACAGAGGTCACGTGGATTTAAAGAGCCTGCGGGCC
CACCTCGACCGGAGTAGACCAGGTAGAAGCtgtctccgtcgtctcccTAAAGAAAACAATAAGTTCGCCGCCCGACACATAACTAACAGTGCGAGGAAAC
ACCAACCTCGTGGAAGACATACGCCCCCTTGTCATTGTATGCAACTATCTCAAGAGATTGATACAGTCGATCAAGCTACGAGCACCTTGAGTCAAAATGG
AGCGCAGCAAGCTCAGTAAAGTTACGGACGACATTCACCTTAACTAGACAGAGCAAAGGATGCGTTAACTCAGGCCCAGAAAATCATTATCCGGTAGAGC
GATACGCACAGGCGTCCAAATTAGTGAAGAATCCCAGCAGTTTGGACGACGCGAACAGTGATTTGAGCTGCACATttgcaacaacagcaacaataGTCAG
actcgagagcagcagccattGTATGAGAAGTCAACCCACCACGTGGATATCCTCTAGTGTGCGCTTCCCTGTCGGCTTGCGCAAGATGGTTCGACACACG
TTTATCTGCGGACTCTTGTGCTCGATGGCGCGCAGGAAGGCGCCGTCGCtggccatctcctccatctgcgACGCCAGCGACCTGCGCCTCGATCCGCTGC
TCCCGTTTGCCACAGCCacatcctcctcttcctccatttTGACACAGCAATAACAACTATGTGCTGTGGCTTGAAAAAATAAAACCAGGATGAAAATAGC
ACACTTCAACACGATCCACCAATCAGTTCCGTGTATTTTGGGTCGAAATAGTCCAAGTATTGGTCGACTACAAAACAAATCTGCCTTGATTAAAGTATGC
TTACCAAATTTGGTCCTTTCATCATGACGAGGGAGACCTCGTGGGTAGATGACGCTGCGCAGCGCCTGCGTCGCCACTTCACCAGCGACCGGTCGGTCTC
CGTGTACGAGTCTCTCACTGCGCATGTCCTAGACGCAGCCACGGGCGGCGCGCTGTTCCTGGGGGGCGTTTCAGCGGCGCAAGTGGTGCAGAAGGTGCTG
CGCGTCGGTTCTGCCTCTGGATTTCTGCTTCCTCAAGCTCTGggggctgctgcagtggcttcttcctccgtcttggCGCTTCACTTCGCCTCCATCCCTC
GAGAGGTTTACCAGGAGATTGCAGAGCAGAGTCGACGACGCTCCAGTGGCTGGAGTTGGCTCGTACTGGGGGCCAAGAACCTGCAGCCGCCCACAGCCTG
GAAAGCTGCCCAAAATAAGCTCCAGGAACGCTGGGAGGACCTCCCACAAGCCCCTTATCCAGTGTACATGATCATGGGACTGCTGTGCTTCAAACTGCTG
GGAGGGCGCATGAGTGCATTGGCACCTTCGCCTTATTCCAACTTGGGGGCTTTCCACCTTAAGAAGGCTTCACTGCCAGCTACAGCGGAGTACGCTACGA
GTGTGGAGAGAGGGATCATCCAGGAGTTCGGGCGTCTCTATGGTTGCCACACGTGCGGCATTAAACGGGGTGTGCGGTACCATGCAGACCACATGCCTCC
TAAACTGTAGGCCGTAGCAAGTACTGACTGACTTTAACTTGTGTCTTTATGCTGACTTAGCGCCTCTCGCTTTTTGGTGTGTGTAGGGTGGCGAAGCGCA
CTGATAACCAGTTTTTCAGAAAGATATTGGGACGGCAGACCAGCTTCCGTTTCTACCCGCAGTGCGAGCCGTGCTCCAACCAGCAGGGAAGCGTCGTGAA
GCAGTGGAAATCCACATTGAAGATGCATCTGCTGTCCTTCCGAGGGTACCACTCGACAGGGCTGTGGCTCGTGCTACTCTGCACTGGTGGCCTCTACGTC
GGAGGATCGAGCTTCCACGAGACGTCGGAGGTGGCGGATACGTCAGAGACTTCAACGTCCTCGgacttctcgctgctggtggctttGCGTGAGAGGGAGC
GGAAGTTGCGTCGTGAACGAAGGAAAGCGAGCGATTCCAGTCAACGCGCTGCCATCGATaaagagctggaggcggtaGCCGAGTGCATGACAGCCATCAA
AGCCGACATCAAACGGCAGGCGGCCAAGTAGTTAACAGCCTTAACAAGGAAGCTTCGGACTGGTGAGTATCGGCTTTGGCGCTTTGAGGAGTTTCGAGCT
ATTTCCGTTGTGTTGATACTAGGACTCTTGAACGCACCTCGTCACTCGTGGAAGCGAACGGGGCTATGGCGGCAACCAAGCGAGAATCTGCGGTCCTCGA
TCAACGGCACCCAAGGAAGACCGGCGTACGCAAACCGAACCACCCACTGCGAGGTCACCGCCACCTCGTCACATtgtccgaggaggagatttcGAGGCGA
GAGCAAGGCTGGAACGATCGTTTTACCGTGGATCCACCGCCCAAATCCAACAAAGTTCTGTCACCTGCCAATTCGCCAACGTACAGCACCCCGCCAACTC
CGCAAACGAAGGAGTCCAAGACTCGTCACGAACGCGCACAATATGGTTGGAGGATCGCTCCTTGTATAAACTCTGCGTTTCACTcacagctcgttcacgt
GACAGGTAAACGTggtggaagacgaagtcgTGAGCCAAAGAAGCCTTCAAGTGGGAAACTGATGCCTCTGGGCACTTTGTCAAAACCCCCTTCTGTACGT
ATCCATCTATTGGACTGAGCTGCACCAATTGCTGATAATGTGCAATGTATATGTGCTTAAACacaggaagcagcacaacccacgaaagaagaaaagctgC
GTTTTAAGGTCTTAAAAGCAATCGACGCCCGCGAAACGCTGCTGTATCAGTTGAGCGCTCTGATTCTCTGCACACCAGCACAGGAGTCGCTCTTCCTACC
GTCTAGACCTACGGAACCCCCAACGTCGAACACTGGAGGTCGGCAACAGATGCGCTCGAGAGGAGGAATGGCCCTTGCGTCGACCCCATTGAGTCGACAC
GGTGGAGCGTCTGGTGCAATGACAAATGCTCGAGAGGCTACAAAACTAGCGCAACAACTCGCCACAGACCTGCAGGTTACCGGGATCCAGTGTGTTGAAG
CTTTGGTCGAATGGATGCTGGAGGCTGGAGCGCAGGCAGAGTACGCGCTTTTGATTAACCACTAGACACTCCTGTTTAACTGTTATGTTGTTGTGTCTTC
ATAGAACCCCTCCTCCATTCTTGTGGCGGGGACGCAACTACTTTCTGAAGATGTTTGGCGACTTGGATTTTGCAGAAGCAGAACTGCAGGCGAGAGGAGT
CAACTTGAACTGCTTTAAGCAACACAATCCCTTGCTCATCAAGCCGAACCAGAAATTGGGTCGTGTGCTGGCTGCTCACTCTATCATCATGGAAATGATC
GAGTTTGCGAAAGACATGACGCCAATGGAACTGCTGGCACT