Description :
From Genome Similarity Track
Location :
Scaffold_870:1863- 3978
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_870-snap-gene-0.10Flagellar protein

Sequence
2115 bases(100 bases per row)
AGCGAACCGCTCTGGCAACGTGTTCGCAGGCCGACTGGACCGAGTCTTTGAGGAACCGCGTCCGCCTCGCGAAGAGTTCCTGTTCATACCGAATCGCCTT
GAGGAAGTTGCTCGTCGCGATGTCGAtcGACgCACGAGGAAGcAGCGCAACAGAGGACaCAGGCGTCGCCGTCGGGGTCACAACAGGCGTGTTCCCAGTC
TTcCCACCTTTGCCACTTGGAACTGGCGTCGGAGCGGGTGCAGGTTCAGGAGCCTTCGCTTCGTCCTGCTTTGCCGGtGCACTCACGATCATCTGTACCA
GTGCCTCGGaCCGTAGAACGACGGTGTCGTACGCGAGGAGTCCTTCGGTTgATAAGGGGTCCACGTTGGCTGCTGGATCCAAGGCCCCAGCTCCTGCGTG
GACAGAGGgCGTGGGGACAAGTGGcGGCTTGCCCTTtGCTCCTTtCGCACCCGCAGTCGTCTTAGCCGGCGTCGGTGCAGCCGCTGGAGCCACCGGAGCA
GCCACTGGCTCCTCCGTTACATCGGTGAATGTCTTGAGTGATAGCTCACTGAGCAACGCATTTGCAGCTGACGTCTtGAGCTGTTCGACTACGCCCAGAA
GATGCGCAGGCTCATCGCTGGCCGCCACGAACGTATCTACTAGCAGTTGGACAGACACTCGGAAACGATCACACTCAGCTTGAAGTATGCGCTGGTAAAG
CAATGAAaTaTACTGGCACATGTCGTCCGTCCATCCGTCAGTGATGATATCACGCAGTTCTTGCTCACTGTCCTGACGCTtCTTTACTGAGAGATCACAC
AACTCGTCCTGCAGAACGTCGACACGCGCATGGAGCTCCACTTTCGTTGCGTCTTCAAAGCGCATCTCCTGgATGACGGAGTTGAACTCGCGCTGAAATG
CGTTGACGACAGTCTGGCGCGCGTCCATACGACGTGCGAAGAGTGCCATTGTGTCCATGACCCATGTCaCTCGCTTTTCGACCTGTTCTCGTtGTTGACG
AAGCAGCACGAAGCACTGGCGCATCACGCGCGAGTAATCCTGCTCCATACTATCCCAAATCGATGCTAAGACTTGCCCCAAGTCAGGAAGTAGCCTATTC
GAAAACAGAGTTCGAGAATTCCGCACTTGAAGAGACTCCTCAAACAGCCAGTCGCGTGCACTGACCAACGCGGACTCGACCAGCTTTTTCGCCTCTTCCA
CGgCGACCTTGAGTTCAGCTACTTCTTCCTTTTTGgCTTTGGCTTcTTCAGCATGCTGCACTGCCAGTTGGGCCTTGTTGACATCCTCCTGAGCTAGTAG
GATCCCCCTcTTCAGTTCATTCAACTTCCGTTGGCGTGCTTCCTCCTCTTGCATTTGTGTTGTTTCGTCATGCTCCTTTTCGCGTTGTTTTTGCTGGTCT
CCACTTTGCCGCTGCTCAAAATACGCGTCGATCGCGTCACATATCCGAGTCAGAACAGCGTCTTTCGTCAGAGCACGAGTCAACACTGCGACGGATTGGC
CAGGCTGTGATTCTGtCGTTtCCACCTCTCTCAACGAaTCGAAACGGCGATACCAGGGCATATGTTCTGTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTTCGGTAGCGGTGGTCTAGCACATCCAGGTGCAAGGAAAGATTCGAAATCGAACGGCGAGGGAATTtGAGAAGGCTCTTTGAATCC
TGTGAGATGCTCTTCAAGCGCTTGAGCATGGGCCGAAGTCGCTGGTAAATCGTACAAAATCCACCGATTTtGAAAgCGAGgTTCTAAAAGTTCAATGGCA
TCCAGCACGAGTTGA